Q: What is required to form a phosphodiester bond withanother nucleotide ?
A: Biochemistry is the study of biochemical functions at the molecular and cellular levels using…
Q: Who developed the sequencing-bysynthesis (SBS) approach? & When it was firstly used ?
A: Sequencing by synthesis (SBS), an Illumina sequencing method, is a commonly used next-generation…
Q: What are chimeras ?
A: A chimaera is a person that carries two completely different sets of DNA in their body. Sure, it's…
Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 lb. 3/195 of the F2…
A: Parent aabbccdd = 5lb AABBCCDD= 29 lb
Q: When is a tetrad specifically formed? Would it be found in a haploid or diploid cell? What event…
A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading…
Q: DNA polymerase l moves toward the direction of replication fork creating Okazaki Fragments. * True…
A: Most living organisms that are well defined in terms of that they have DNA as their genetic…
Q: How can the heart be strong enough to pump blood up your legs against gravity?
A: The heart is incapable of pumping blood back up the veins in your legs and back to your heart on its…
Q: 11. Choose from the following types of inheritance and write in the 1st column which one is…
A: Mendelian inheritance states that the genes assort independently but this doesnot apply to every…
Q: What is false about the image below? The cells are part of plant ground tissue B) The cells are…
A: * Ground tissue is all tissue in a plant include parenchyma and collenchyma and schlerenchyma. *…
Q: B5. When a tapeworm obtains nutrition from the human intestine, but causes harm to the human host in…
A: Different types of species interactions are found that are classified according to their nature. In…
Q: 1. You are observing an unknown vertebrate whose limbs are probably vestigial. What are the possible…
A: A limb is a jointed appendage in humans and numerous different animals use for locomotion like…
Q: Explain comprehensively how the ganglia originated embryologically? How do these affect the role…
A: The nervous system is the body's command room. Starting from the cerebrum, it controls developments,…
Q: The recognition sequence to which RNA polymerase binds at the initiation of transcription is found…
A: Ans- False The recognition sequence to which RNA polymerase binds at the initiation of transcription…
Q: 1 pts List the following events in order as they would occur inside a skeletal muscle fiber: 1)…
A: The signals of contraction of muscles are carried by the nerves at the neuromuscular junction…
Q: Why is the gap junctions between heart muscle cells play a relevant role in producing a regular…
A: Only the heart contains cardiac muscle tissue. Cardiac muscle contractions are well-coordinated,…
Q: The MN blood group is of interest to population geneticists because (a) people with genotype MN…
A: Blood is classified into four types based on the presence or absence of antibodies and antigens on…
Q: Which of the following genetic mechanism isn't used by bacteria in the transference of genetic…
A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer…
Q: butterfly wing bird wing un What is the function of each of these structures? How are they different…
A: Analogous are comparable attributes shared by two unique creatures as a result of convergent…
Q: 1. A woman is colorblind. Construct a Punnett square and using versions of the letter “C” determine…
A: As per our company guidelines we are supposed to answer only first question or first 3 subparts of…
Q: what is the purpose of calcium ion in fertilization?
A: * Fertilisation is an generative fertilisation fusion of gametes gives rise to a new individual…
Q: What are the different groupsof fungi?
A: Introduction In this question we will discuss about the different groups of fungi.
Q: Which of the following enzymes do not require a DNA template for nucleotide synthesis? *
A: DNA template is a DNA strand which is copied in to a complementary strand of DNA. According to the…
Q: Discuss the role of par genes in generating anterior/posterior polarity in the C. elegans embryo.
A: C. elegant is a nematode that is used as a model organism in developmental research. Six proteins…
Q: In _______________ the selecting agent is the environment, whereas in _______________ the selecting…
A: Introduction Natural selection is the adaptation and modification of populations of living…
Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…
A: The guinea pig, also known as the domestic guinea pig, is a rodent species in the Caviidae family.…
Q: The megaspore mother cell of an angiosperm has a diploid chromosome number of 2n=32. This megaspore…
A: The embryo sex formation in angiosperm is very interesting and unique feature that follows a…
Q: escribe the important characteristics of gymnos
A: Plants- These are multicellular organisms that can be distinguished from other living things by a…
Q: 1. The is the side of the epithelial cell that faces the external environment or an internal…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: Charles Darwin once said, “It is not the strongest of the species that survive, nor the most…
A: This is a misquote with special reference to Charles Darwin regarding The Origin of Species in 1859.…
Q: how the Americans with Disabilities Act and related standards for design have sought to improve…
A: Americans with Disabilities Act(ADA) Proposed in the year 1990, It provides equal rights to disabled…
Q: Independent assortment means that: the segregation of one gene pair occurs as if no other gene…
A: The law of independent assortment states that the alleles of different genes are inherited…
Q: ion ) parenchyma
A: Plant cells are photosynthetic eukaryotes. These belongs to the kingdom Plantae.
Q: Are there any parts of the human body that get oxygen directly from the air and not from the blood?
A: The answer is YES.
Q: Define 'oestrus' and 'menstrual cycles.
A: There are a few key ways that pregnancy and the menstrual cycle are related. First, both involve the…
Q: A critique is a genre of academic writing that briefly summarizes and critically evaluates a work or…
A: Critique analysis is evaluation of text, it is subjective writing. The purpose of critique is to…
Q: Are there any safety concerns with teaching a cat in this way?
A: Learning is defined as any relatively permanent change in behaviour that occurs as a result of…
Q: Can the frequencies of all genotypes in a population be determined directly with respect to a locus…
A: The dominant allele causes a dominant phenotype in an individual and is composed of one copy of any…
Q: 2. How can you help preserve the rich species diversity of the Philippines? 3. Why is it important…
A: Biodiversity means different types of life forms or species that exist on the earth. Human…
Q: A woman who has A blood type (her mother had blood type A and her father had blood type B) has a…
A: According to our guidelines, we are required to answer only the first three questions in case of…
Q: What is an ecological footprint? Explain what is meantby the term overshoot.
A: An ecosystem is usually defined as the way they are sated as the community of living organisms that…
Q: The experiment uses a redox titration method to measure Vitamin C content in a tablet. Why you…
A: * Vitamin C ascorbic acid is an antioxidant essential for humans this deficiency can lead to a…
Q: How do mitochondrial proteins interact with IAPs to prevent inhibition of apoptosis?
A: Multicellular organisms experience apoptosis, which is a type of programmed cell death. Cell death…
Q: Explain how and why the Queen bee abort the sexual maturation of the worker bees?
A: * Honey bee Colony consists of three types of Bees A single queen Hundreds of male drones…
Q: The fossil record (a) usually occurs in sedimentary rock (b) sometimes appears fragmentary (c) is…
A: All life on Earth descended from the universal last common ancestor, who lived between 3 and 4…
Q: Discuss how mutations in the 5’ splice site, 4’ splice site or branch point of an intron may disrupt…
A: Splicing The process after transcription from which introns or non coding region of RNA is removed.
Q: Describe the ways in which each of the following pathogens can disarm their host’s immune system or…
A: There are a number of different ways of evading or subverting the immune response. These…
Q: Design a laboratory protocol to develop a monoclonal or polyclonal antibody against a protein of…
A: Antibodies, also known as immunoglobulins, are protein molecules produced by the body's immune…
Q: _snRNP of the spliceosome recognizes to the 5' splice site through conventional base-pairing. These…
A: Splicing is a process that removes non coding sequence of genes from pre mRNA. Non coding sequence…
Q: The evolution of beak size in the various species of Galápagos finches is associated with their (a)…
A: Introduction:- The cumulative changes that occur in a population over time are referred to as…
Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…
A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…
Step by step
Solved in 2 steps
- Explain why consuming food rich in vitamin A can help to prevent night blindness. Explain why deficiency of vitamin C causes scurvy. Explain why vitamin B12 deficiency can cause megaloblastic anaemia.The concentrations of lactate in blood plasma before, during, and after a 400 m sprint are shown in the graph.(a) What causes the rapid rise in lactate concentration?(b) What causes the decline in lactate concentration after completion of the sprint? Why does the decline occur more slowly than the increase?(c) Why is the concentration of lactate not zero during the resting state?What is the root cause of Duchenne muscular dystrophy? What is the normal function of dystrophin?
- Explain what happens in regard to BP when a person changes from a supine to a standing position. Why does this occur?What does this indicate? Is ONPG positive or negativeIn your own words, define polycythemia. Also describe how athletes can artificially induce this condition. What problems are you more at risk of if you have polycythemia?