Q: Write a conclusion explaining the relationship between time and temperature
A: *The higher the temperature, more easily bacteria will grow to a certain point. *Very high and low...
Q: Explain how temporal and spatial variation can change outcome of competition (which means you need t...
A: Spatial variation: Some specific places are benificial to the organisms to survive, so if the variat...
Q: Explain the following statement: The O2 generated by photosynthesis is simply a by-product of the pa...
A: Photosynthesis is the process by which plants prepare their own food with the help of sunlight, wate...
Q: In fruit flies, brick-red eye color is dominant to a bright orange color called cinnabar. A fruit fl...
A: The correct Answer is C
Q: 2. Distinguish among inducible, repressible, and constitutive gene operons.
A: An operon is a functional unit of genomic DNA that comprises a collection of genes that are all regu...
Q: Hand drawing of a forest ecosystem foodchain
A: Introduction: A food chain is a linear sequence if organisms representing producer to top consumer o...
Q: QUESTION 1 Ion pumps.. DA Use the energy of ATP hydrolysis to move ions against their concentration ...
A: Ion pumps use energy from ATP hydrolysis to transport ion against the concentration gradient. They c...
Q: Which of these is likely to reduce enzyme activity? Increasing pH level II. Decreasing temperature I...
A: Option A- Incorrect Explanation- Optimal enzyme activity depends on the optimal pH of the surroundin...
Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...
A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...
Q: 1) What makes the heart sounds? 2) Know the whole cycle/route that the blood takes from the heart th...
A: 1.Blood does not pass back from the atria into the great veins because the roots of great veins are ...
Q: A bacterial cell undergoes a change and the two Trp codons of the tryptophan leader sequence are con...
A: Tryptophan operon is an example of repressible operon which remain transcriptionally active and beco...
Q: A 60-year-old woman with history of lung cancer is admitted for weakness and lethargy for 4 weeks. H...
A: The correct option is C.
Q: Topic: Isolation of Crude Ovalbumin from Egg White by Ammonium Sulfate Precipitation (Salting Out) ...
A: Egg white It refers to the clear liquid present inside the egg. It is formed from the layers of secr...
Q: The world has been greatly affected by the pandemic caused by COVID-19. Countries all over the world...
A: The pandemic caused by the novel Corona virus has devastatingly affected the countries around the wo...
Q: b.
A: The given figure is a diagram of animal cell.
Q: Glucose molecules are fully reabsorbed in the proximal tubule that normally, zero amount of glucose ...
A: Glucose is a form of sugar that is the main source of energy in our body.Normally, glucose is not or...
Q: When a cell reproduces by mitosis and cytoplasmic division, does its life end?
A: Mitosis is a process that results in the formation of two daughter cells that are identical in natur...
Q: dogs have a diploid chromosome number of 78. Howmany chromosomes do their gametes have?a. 39 c. 156b...
A: Diploid refers to the number of complete chromosome sets present in each cell of an organism. Diploi...
Q: Describe the bacterial colonies providing information on shape, color, size, elevation and edge appe...
A:
Q: It is the process where the parent's gene pairs separate.
A: Separation of different traits of the same gene or allele pair during meiosis so that they can trans...
Q: If the pressure in the ventricles is higher than the pressure in the atria, but lower than the press...
A: Heart valves open and close in response to pressure changes inside the heart chambers. the fluid und...
Q: Which of the following statements about the world population is NOT true?
A: Analysts estimate that the global carrying capacity of the earth is about 50 billion. The world popu...
Q: MATCH EACH WITH THE LETTER. 1. RIBOSOME 2. NUCLEUS 3. ROUGH ENDOPLASMIC RECTICULUM (ER) 4. SMOOT...
A: Matching of cell organelles with their functions :-
Q: Describe the symport process by which cells lining the small intestine import glucose. What ion is r...
A: Active transport includes the use of metabolic energy for the transport of substances.
Q: I. Answer the following: 1. What are the main elements of the lac operon and their functions? 2. Dis...
A: Definition:- An operon is a group of genes that are transcribed at the same time. These are a featu...
Q: Does the DNA content of the cell change from the beginning of interphase to the end of interphase? D...
A: Mitosis Mitosis is a process of cell division, where a single cell divides into two identical daught...
Q: (a) Gryllus pennsylvanicus prefers sandy soil. (b) Gryllus firmus prefers loamy soil. Based on the i...
A: Geographic, behavioural, physiologic, or genomic obstacles or differences that prevent a species fro...
Q: Do you think the scar would look better (i.e. the wound heal "better") if friend #2 underwent hyperb...
A: This is because the scars of Tb never heals, it cannot be reversed under any circumstances, even whe...
Q: How is the shape of the bacteria related to it's function?
A: Coccus (spherical), bacillus (rod-shaped), and spiral (twisted) are the three basic bacterial shapes...
Q: Answer and explain comprehensively. 3. If humans evolved from apes, then why are there still apes?
A: INTRODUCTION Evolution is a main thing happened by a natural process that mainly occur...
Q: Mechanisms that govern gene expression do not operate during______ . a. transcription c. translation...
A: Gene expression is a process in which a gene is expressed into a gene product. A gene is a piece of ...
Q: After adding ammonium sulfate, the mixture was allowed to stand with occasional stirring for 30 minu...
A: Salting out refers to the decrease in solubility of proteins in the presence of very high salt conce...
Q: are my answers correct?? there were blank spaces
A: The DNA consists of 4 nitrogen bases which are Adenine (A), Thymine (T), Guanine (G), and Cytosine (...
Q: Often reliquishing the young ones owing to food shortage is one of the common behaviour exhibited by...
A: Animal behaviour is the research of how animals navigate around in their surroundings, engage cooper...
Q: compare these two techniques. Compare a nucleosome protection assay and a northern blotting is a tex...
A: Introduction: The nucleosome is the fundamental subunit of chromatin. Each of the tiny beads are cal...
Q: Alzheimer's disease :the prevalence of the disease in the population. - include reference
A: Alzheimer's disease is most common in Western part of the Europe and least common in Africa. White p...
Q: DNA pol 3's inability to begin the replication process is solved by which enzyme? helicase primase D...
A: DNA is genetic material in most of organisms . It act as template for synthesis of its own . This pr...
Q: A marathon runner was disoriented and delirious post-race, and was found to have a serum [Na ] 128 m...
A: The correct option is C.
Q: What property of the various cytochromes ensures unidirectional electron flow along the electron-tra...
A: Cytochromes, a family of metalloproteins which performs one-electron transfer reactions, in biologic...
Q: When two long-winged flies were mated, the offspring included 77 with long wings and 24 with short w...
A: Introduction :- A recessive gene is one whose effects are concealed when a dominant gene is present....
Q: what is ASTO or ASO test? discuss the principle it's important
A: ASTO/ ASO test is Anti- streptolysin O test. Antistreptolysin O is an antibody produced in human bo...
Q: DNA to Protein 1. Describe the mutation that created the Hbs allele: type of mutation, location of m...
A: sickle cell anaemia is an autosomal linked recessive trait that can be transmitted from parents to t...
Q: Which is NOT a question that science can answer: (a) Does taking ginkgo reduce the chance of Alzheim...
A: * Gingko biloba is an extract that is obtained from leaves of the Ginkgo biloba tree. * It is believ...
Q: Acetylcholine: is the neurotransmitter in the parasympathetic nervous system. is the neurotransmitte...
A: Introduction: acetylcholine is a neurotransmitter, it is an ester of choline and acetic acid. acts a...
Q: Answer and explain comprehensively. 3. If humans evolved from apes, then why are there still apes?
A: Apes meaning and explanation For much of history, people have used the terms "monkey" and "ape" inte...
Q: Describe the bacterial colonies providing information on shape, color, size, elevation and edge appe...
A: Different types of bacteria form different types of bacterial colonies which differ in their morphol...
Q: Which precedes an action potential traveling down the axon of a neuron? A. Neurotransmitters bind to...
A: The right Answer is A
Q: 1. Let's imagine what would happen to the amount of DNA material in a cell if, when it reproduced, i...
A: * During mitosis there are the following phases G1 phase S phase G2 phase M phase * During G1 pha...
Q: The enzymes BamH I and Bal II recognise different sequences but leave the same sticky ends: BamH I: ...
A: Restriction enzymes or endonucleases are enzymes that recognise particular DNA sequences at the rest...
Q: The study by Wakefield et al. that purported to show a link between autism and the MMR vaccine was p...
A: Answer- (d) All of the above
What are three behaviorally measured outcomes of attention?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What is distributed respresentation? How is distributed respresentation related to the multidimensional nature of experience? How is distributed processing illustrated by how the brain responds to looking at faces, remembering and language?Larsen and Buss note that two of the initial aspects of the self that children between the ages of two and three years old learn to identify and associate with themselves are 1) sex (male or female) and 2) age. Why are sex and age among the first aspects of the self that children notice and attend to? Why don’t children notice some other aspect, such as ethnicity, weight, or shoe size?What is RLE (related learning experiences)?
- Consider activities that you engage in on a daily basis, such as driving a car, choosing what to have for lunch, speaking with a colleague, or other normal work functions How do these cognitive processes help you adapt to your environment?How is experiencing empathy important?What is the role of emotional intelligence in the classroom? How might emotional intelligence be tested? Should emotional intelligence be a factor in determining academic promotion to the next semester?
- What are the two classification of neurological research? What are their strengths and weaknesses?What is the oblique effect? Please provide behavioural and neural evidence for this effect and explain why are those raised in modern environments more likely to show this deficit than those raised in premodern circumstances living in tents or teepees? //// Cindy drives home through the busy inner-city, and Jason takes the relaxed country road home. Each of them has a noisy kid in the back seat. For whom should the noise be a bigger distractor? Which theory and evidence can you use to justify this prediction?Which are the four perspective of ordinary motivated behavior?
- What are several procedures that increase attention to the left side in a person with spatial neglect?How do the Huge Two meta-traits of personality relate to creative self-concept and performance on creativity tasks requiring (a) convergent cognitive abilities and (b) divergent cognitive abilities?What do we mean by neuroplasticity and what does the neuroplasticity theory argue?