What are the physiological advantages in sport due to using testosterone? What are the physiological consequences of using testosterone? Give an example of a Professional Athlete that used testosterone (Armstrong does not count).
Q: Which one of the following features is common to both RNA and DNA? Contain just four types of bases ...
A: DNA and RNA both are nucleotides that contain genetic information of the organism. RNA is produced f...
Q: How many individuals need to be genotyped in order to get an acceptable estimate of the rarity of al...
A: The human beings are made up of numerous millions of alleles. The alleles can also be termed as trai...
Q: Describe how direction is determined in nucleic acids. Also identify the "normal" direction that is ...
A: The nitrogenous bases are stacked in the interior in pairs, like the steps of a staircase; the pairs...
Q: How can you integrate sustainable energy options into your homes?
A: Energy is required for all type of work in the world. Every process is energy driven. The major sour...
Q: how chemical bonding stabilizes a specific secondary structure element that is present in your PDB p...
A: Answer: Protein secondary structure is the three-dimensional form of the local segment of protein. ...
Q: Certain human emotions are plausibly part of the facultative machinery that supports altruism. Illus...
A: Reciprocal altruism is a behavior in evolutionary biology in which one organism acts in a way that t...
Q: provide examples of environmental laws or approaches that demonstrate the risk protection principles...
A: Environmental laws put in place to protect our air, water, and land include the Clean Air Act, the C...
Q: If heritability of dots is equal to 0.9: Group of answer choices The average number of dots for offs...
A: The slope of the regression line is an estimate of narrow-sense heritability. For the high heritabil...
Q: A. B. CH С. O The location marked with the red A. O The location marked with the red B. The location...
A: The genes are the units of heredity of a cell or an organism. The gene is present in the form of tri...
Q: relationship between chronic inflammation and type 2 diabetes.
A: Type 2 Diabetes is the adult onset Diabetes.It is typically caused by Life style .In this Diabetes,t...
Q: Humans have innate immunity for protection against pathogens that may enter the gut along with food....
A: Innate immunity also called natural or native Immunity, consists of mechanisms that exist before i...
Q: The names of the muscles can indicate all of the following, EXCEPT ___________. a.myofibril numbers...
A: Question 1) Answer : Option (a) is correct. - myofibril numbers of the muscle.
Q: All of the following make meiosis different from mitosis EXCEPT O chromosome number is reduced by ha...
A: 2 types of cell division is seen in nature; meiosis and mitosis. Mitosis is undertaken by somatic or...
Q: Poliovirus contains a protein that possesses an NLS.
A: Viruses are intracellular parasites that rely on host cells for completion of their life cycles...
Q: Flow Char
A: The ecosystem on the earth is a cooperative space between the biotic and abiotic factors. All these ...
Q: How might early dog domestication compare with pet dog breeding in the U.S. today? Explain in detail...
A: Early dog domestication- It's found that the earliest dogs in US were not domesticated from local wo...
Q: What is Alu element ?
A: An Alu element is a transposable element, also known as a “jumping gene.” Transposable elements are ...
Q: Discuss G1/S phase,
A: The process through which cells multiply into two new cells is known as the cell cycle. G1, S, G2, a...
Q: label what is being pointed at the human ovary
A: Introduction: The Graafian follicle is a fully grown follicle that ruptures during the ovulatory pha...
Q: 2. Mrs. Gulliver wants to find out whether or not Miracle Grow really makes plants grow faster. She ...
A: Basic Needs for plants to Grow --- Plants can not walk from place to place in search of resources .P...
Q: Identify the monomers for the following polymers A.) Maltose B.) Sucrose C.) Lactose
A: INTRODUCTION The monomer of the polymers is given below.
Q: A cell's DNA has 40% cytosine bases. What percent of its bases are guanine? O 10% O 20% O 40% 80%
A:
Q: Match the pattern of inheritance to the appropriate term. Group of answer choices 1. Recessive epi...
A: Heterozygotes having different alleles show better survival in many cases. This is called heterozyg...
Q: In tertiary protein structure, the side chains of two cysteine residues are sometimes linked to each...
A: There's one special type of covalent bond that can contribute to tertiary structure: the disulfide b...
Q: If one person with the trait of Huntington's disease (H h) has 2 children with a partner who does no...
A: INTRODUCTION Huntington's disease It is an inheritable disease in which nerve cells in the brain bre...
Q: Define ovarian ligament
A: Ovaries are the primary reproductive organs and site of female gamete production.
Q: Tests Indication/Purpose Procedures/ Specific test sample used Draize Acute Skin Irritation Test Dra...
A: The Draize rabbit test process entails the forceful application of the test material to the eye or s...
Q: 13. The variable an experiment where no manipulation is done to it. 14. This species concept focuses...
A: Eukaryotic organisms The organism that have membrane enclosed organelles.
Q: 4. The number of kingdoms in our currently biological classification system This type of experiment ...
A: Introduction :- The biological kingdoms system is a classification method used by science to classif...
Q: Poliovirus contains a protein that possesses an NLS. A drug is developed that binds and hides this s...
A: NLS or nuclear localization signal IA an amino acid sequence that tags a protein for import into the...
Q: In an experiment focusing on weight gain between ages 3 and 6 weeks in mice, the difference in mean ...
A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up ge...
Q: What is the difference between a food vacuole and a vesicle?
A: A live organism's basic structural and functional unit is the cell. A cell, according to cell theory...
Q: Which of the following levels of protein structure may be affected by hydrogen bonding? (a) primary ...
A: Protein is the biomolecule which comprise the one or more long chain of amino acids which belongs to...
Q: As a graduate student, you have been studying the genetics of heat tolerance in a population of fiel...
A: Gene has a vital role in the bodily activities of all organisms. So the study of their specific role...
Q: . Analyze the purpose and advantages of having a universal classification system.
A:
Q: Explain how RNA copies are translated into the two enzymes ?
A: RNA stands for RIBOSE NUCLEIC ACID, which is a double stranded molecule.
Q: What fact can lead a person to accidentally overdose if they use a drug after an extended period of ...
A: Tolerance is reversible
Q: what becterial cell structure serves as the site of antibacterial action? a. cell membrane b. nucle...
A: Note: As Per Bartleby Guidelines only first question is answered.For Further Answers Please Repost T...
Q: 1. The human brain consumes about 20 watts and has a mass of 1-2 kilograms. a. Estimate the fraction...
A: At repose, the average human generates roughly 100 watts of electricity an our brain uses around 20 ...
Q: What is this figure showing (overall first)? What is happening at each step? How are the little circ...
A: The neurons are the cells of the nervous system that are responsible for the generation and transmis...
Q: Draw a representative agarose gel showing the bands, and the direction of current flow as well point...
A: When we will digest the clone with EcoRI then we should get two bands on an agarose gel. One will co...
Q: In the U.S., which of the following drugs is most commonly used? nicotine cannabis O alcohol O cocai...
A: Cannabis.option (b)
Q: explain why an increase in plasma viscosity will increase the ESR
A: NOTE- As per Bartleby rules and regulations, we are supposed to answer only for first question. Will...
Q: [SELECT ALL THAT APPLIES] A prokaryotic ribosome is made up of the containing two subunits viz. the ...
A: Biofilms are multicellular communities made up of bacteria wrapped in a non-crystalline extracellula...
Q: Being able to digest lactose after the age of four is common / uncommon (circle one) around the worl...
A: Lactose intolerance is a phenomenon in which plateaus of the dairy product is not completely digeste...
Q: How Lactose Metabolism in E. coli Is Regulated ?
A: Escherichia coli can be referred to as bacterium comprising a set of genes that can play an importan...
Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five ...
A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5 deoxyr...
Q: Explain why blue tits in France were unable to experience local adaptation (i.e., timing reproductio...
A: Hi
Q: 2. Is reassortment between just one avian strain and one swine strain of influenza likely to pose a ...
A: Swine flu and avian influenza are selective in the acidbinding compounds found in cell surface glyco...
Q: How do human activities negatively affect biodiversity? Cho A introducing invasive species
A: The three human activities negatively affect biodiversity that apply - introducing invasive speci...
- What are the physiological advantages in sport due to using testosterone?
- What are the physiological consequences of using testosterone?
- Give an example of a Professional Athlete that used testosterone (Armstrong does not count).
Step by step
Solved in 2 steps
- What would be the NEGATIVE consequence for athletes who use an excessive amount of EPO as a performance-enhancing substance? Increased oxygen-carrying capacity of white blood cells Increased hematocrit, blood viscosity, and risk of stroke Reduced testosterone and testicular atrophy Increased heart rate, blood pressure, and risk of heart failureThe figure shows that many male powerlifters had testosterone levels below the 10 nmol/L threshold, (lower than average testosterone levels of male athletes in other sports). Do lower testosterone levels result from some aspect of powerlifting training or do men with lower testosterone levels have an advantage in powerlifting? What does this have to do with effects of testosterone, skeletal muscle, lung capacity, energy storage and consumption?The following are characteristic of testosterone use, EXCEPT a. Muscle Hypertrophy. b. Increased haemoglobin. c. Increase in number of fast twitch muscle fibres. d. Increased protein synthesis.
- What are the possible harmful effects of using anabolic steroids to increase muscle mass and strength?Sex hormones such as testosterone and estrogen use steroids as building material. True or false?What effect will the addition of a sulfate group have on the properties of Testosterone? Why is this important? Note:Need answer urgently (within 30 minutes)
- List major cell type and target organs for testosterone and other androgens.Until relatively recently, the use of androgens by athletes was a common, legal practice. What are the advantages of using androgens during athletic training and competition?What is a steroid? What are the causes and harms of steroid use?