Q: Which of the following enzymes relaxes the DNA double helix to avoid tensional force from supercoili...
A: DNA ligase:- DNA ligase works by catalyzing the formation of a phosphodiester bond between nucleotid...
Q: Explain : Vpr counteracts LAPTM5 to promote HIV-1 infection in macrophages
A: Vpr means viral protein R and it is a HIV gene and protein product. This gene is responsible for vi...
Q: In individuals affected by cystic fibrosis, salt crystals may appear after perspiration dries up. In...
A: Cystic fibrosis It is an autosomal recessive disorder that affects mucus-producing cells. This disor...
Q: Using a Venn diagram differentiate muscular strength from muscular endurance.
A: Muscular Strength:- The amount of force that a muscle can produce in one single contraction. Muscula...
Q: A metabolic pathway_____ . a. may build or break down molecules b. generates heat c. can include red...
A: A metabolic pathway is a set of chemical events seen in biological processes that aid in the convers...
Q: What will be the role of dentist in preventing antibacterial resistance?
A: INTRODUCTION Infections are not mainly respond to the antibiotics are called as antibiotic ...
Q: .32 10 p^2 68 q^2 .46 2pq .1 Number of Mottled 90 Individuals Number of Orange .44 Individuals
A: The Hardy–Weinberg principle, also known as the Hardy–Weinberg equilibrium, model, theorem, or law i...
Q: Which of the following statements is NOT TRUE under the Costly Signaling Theory? Group of answer cho...
A: Costly signalling theory is often interchangeably used with the 'Handicap principle'. CST defines th...
Q: Why is it best to examine a freshly collected stool sample in clinical parasitology laboratory? ...
A: INTRODUCTION In the Medical Parasitology, the specimen collection is an important part th...
Q: ch below with axygen level and function for each heart section. Function: Only identify where the bl...
A: Heart: it is an organ that pump the blood across the body via vascular system. Vascular system: it ...
Q: describe and demonstrate the digestive, breathing, and circulation processes and integrate it with t...
A: Energy required to do all the activities of the body is derived from food . Digestive system allows ...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: Sea urchin development. Basic features of the formation of the axes: A-P & L-R and the role of micro...
A: EMT/Ingression - Epithelial mesenchymal transition is a crucial process for placing the mesoderm ben...
Q: An epitope associates with which part of an antigen receptor?
A:
Q: Please choose all that apply for Phylum Echinodermata. water vascular system endoskeleton O eutely O...
A: An echinoderm is any member of the phylum Echinodermata, organisms belonging to the phylum Echinoder...
Q: Lactate is usually removed from the muscle cells by a(n) that also transports O antiporter, H* O ant...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: For context: This activity will examine the classification of invertebrates and the methods used to ...
A: Invertebrates: the animals lacking backbones and usually devoid of internal skeleton system, comes u...
Q: Why do we need to be aware of cultural differences and be culturally appropriate?
A: The integrated and maintained system of socially acquired values, beliefs, and standards of conduct ...
Q: What traits or innovations allowed movement of animals onto land, and why might these traits have be...
A: Physical or behavioural adaptations are possible. A physical adaptation is a form of structural adju...
Q: 1. Discuss how the transcending functions are associated with the integrative levels of organization...
A: Ecosystems are arranged to help researchers better understand the context in which they are being ex...
Q: Which type of molecule recognizes macromolecules that are present in/on certain groups of pathogens?...
A: Introduction: Phagocytosis is a process in which the phagocytic cells engulf the microbes. It is an ...
Q: What makes the stomach unique? A. Its ability to perform mechanical digestion B. Its tolerance of a ...
A: Let's see which statements are wrong to identify the correct answer:- Option A is Incorrect because ...
Q: Which of the following comprise a DNA helix structure? A. Carbohydrate backbone B. Nitrogenous...
A: 1. DNA helix is a double stranded DNA helix structure . Helix structure means the both strand of DNA...
Q: When light hits the center of an ON-center receptive field, which of the following processes occur: ...
A: The following facts are required to be known to answer this question with logic:- Suppose there is ...
Q: Identify one component of the cell. Describe the structural appearance using your own words Explain ...
A: 1)Cell is the smallest basic structural, functional and biological unit of life.The main components ...
Q: Explain the relationship between turgor and osmotic pressure
A: Turgor pressure allows the osmotic entry of water through a semipermeable membrane into a cell. This...
Q: When the relative abundance of an organism is used to determine the overall health of an environment...
A: Bioindicators are organisms, such as lichens, birds, and bacteria, that are used to monitor the heal...
Q: 6. In Drosophila melanogaster, the wild-type eye colour is dark red. A pure-breeding mutant strain w...
A: Introduction :- The term "purebred" refers to offspring that are the consequence of a real breeding....
Q: Explain the importance of the protein structures (from its primary to quaternary structures) in thei...
A: Proteins are important biological molecules which are involved in normal functioning of biological s...
Q: Hypothesize as to why iron can have an impact on bacterial growth, particularly S. Typhimurium, S.e...
A: INTRODUCTION Iron is an essential element for bacterial growth. Because it's participation in tricar...
Q: Which molecules recognize the TATA box before RNA polymerase binds to the promoter region? Mitotic ...
A: The transcription is the process by which RNA is produced from the DNA. In case of prokaryotic cells...
Q: The mechanisms of evolution that we have learned contribut organisms we have today. We can see these...
A: Endangered species are any species that is at risk of extinction because of sudden rapid decrease in...
Q: investigate anabolic steroids and their use in sports. b. Determine how they affect skeletal muscle...
A: Steroids are the artificially made hormones, as a version of natural hormones.
Q: The same team of researchers sets up an additional cross with this same population. They cross two f...
A: Dominant allele always express themselves in heterozygous condition.
Q: What the grandparents' genotypes are? Why doesn’t the father (II-1) have the disease breast cancer?...
A: Genetic inheritance is the process by which genetic information is passed from the parents to the pr...
Q: Is Thomas Hunt Morgan an interdisciplinary thinker?
A: Thomas Hunt Morgan Native -American Specialization -zoologist geneticist Famous experiment -dorsophi...
Q: A drug designed to inhibit the response of cells to testosterone would alme A. a decrease in recepto...
A:
Q: Describe Brownian motion. What causes it? How does one differentiate between Brownian motion, water ...
A: Brownian motion or movement is that the uncontrolled movement of particles or zigzag pattern of move...
Q: Please answer fast Briefly describe the pathways the body can use to make each of the Big Four clas...
A: The 4 classes of macromolecules are - carbohydrate Lipid Protein Nucleic acid Carbohydrate pr...
Q: Enumerate clinically relevant parasites that can be visualized using the Kato-Katz method in a clini...
A: The most prevalent method of gastrointestinal infection is the contamination of water, food, and han...
Q: The cornsnake (Pantherophis guttatus) has a recessive allele for pigmentation that causes albinism (...
A: Reptiles are the class of Animals that are cold blooded. They inhabit both, the land and the waters....
Q: The common garden pea (Pisum sp.) can have green or yellow pea pods. Green peas are either homozygou...
A: Introduction Heterozygous means that you have inherited different versions of a gene from each paren...
Q: Comprehensive explanation about how the species of finches , that were found by darwin at galapagos ...
A: Natural selection, according to Charles Darwin's theory of evolution, is how evolution occurs. Physi...
Q: QUESTION 4 Which of the following is NOTa part of an inflammatory response? O Edema Histamine releas...
A: Inflammation: it is a natural immune response of the body against harmful agents. Inflammatory respo...
Q: Flg. 1. Breast cancer families 1 to 7. Solid circles, females with breast cancer; open circles, fe- ...
A: Solution:- We are given the following probabilities:P(woman will develop breast cancer gene) = 1/10P...
Q: micrograph
A: The ovary is an organ found in the female reproductive system that produces an ovum . Fertilization...
Q: Discuss the role of the regulator in relation with DNA damage and recombination in the article histo...
A: A histone is a protein that gives chromosomes structural support. Very long DNA molecules wrap aroun...
Q: explain the scope of practice for EMTs in arizona. Is the scope of practice dictated by the state ...
A: Scope of Emergency medical technician is good in Arizona. Avg salary per hour for emt in arizone is...
Q: Identify and explain what insects are expected to have the most sclerotized heads? Does an exoskelet...
A: Scelerotin is typically a brown coloured substance found in cuticles of insects. Scelerotin is forme...
Q: Write a brief discussion about "The path of ethical conduct: Learn to do good
A: Ethics define the set of rules provided by an external source. For example principles in religion or...
what are the different taxonomic classifications of protozoans
Step by step
Solved in 3 steps
- What are the glaring differences in the taxonomic classifications of protozoans used by different literatures?What are the taxonomic problems that are associated with classifying protozoa?Find different literatures on the taxonomic classifications of protozoans. What are the glaring differences in the taxonomic classifications used by different literatures?
- What are the characteristics of protozoans that make them resemble animals?The paraphyletic phylum Choanozoa contains chytrid zoospores and human sperm, among many other creatures. What are some important aspects of the group, in terms of its evolutionary significance?How are protozoa classified according to: Number of Cells Size of Cells Presence or Absence of Nucleus Form or Shape