What are the big differences between eukaryotic (nuclear) and prokaryotic genomes?  How do prokaryotic genomes compare to the genomes found in eukaryotic organelles? Why?

Q: You are tutoring a fellow student about the genomes of prokaryotes. You ask them to give you one…

A: The objective of the question is to identify the correct statement about the genomes of bacteria…

Q: What is the relation between genome size and gene number in prokaryotes?

A: GENOME SIZE Genome size refers to the amount of DNA contained in a haploid genome expressed either…

Q: How does one label the DNA-strands that look like this ---------------------- ----------------------…

A: The replication of DNA is semiconservative. DNA strands are polymers or chains of deoxynucleoside…

Q: How many bases, or letters, are in the human genome?

A: To determine the whole sequence of nucleotides in the human genome, the HGP was initiated in 1990.…

Q: Genetically speaking, prokaryotes are different from eukaryotes because: a. prokaryotes usually…

A: Introduction :- Prokaryotes are creatures without a nucleus or other organelles in their cells.…

Q: How many human genomes are there?

A: Genome is the genetic material of an organism, which consists of deoxyribonucleic acid (DNA). It…

Q: Clearly, all humans have variations in their DNA sequences. How is it possible to sequence the human…

A: Answer- All the organism have certain amount of similarities in the DNA sequnece. In all the human…

Q: Why do we study the DNA sequence of human organism?

A: Biomolecules are the organic molecules present in living organisms. Carbohydrates, proteins, nucleic…

Q: How are the genome structures of prokaryotes and eukaryotes different?

A: A genome is referred to as the genetic material of an organism. This genetic material includes…

Q: The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence…

A: The Central Dogma concept states that DNA is duplicated into DNA. RNA is formed from DNA and…

Q: The RNA World Hypothesis suggests that the earliest forms of life used RNA as a genome instead of…

A: The RNA World Hypothesis is a theory that explains how life on Earth arose from basic chemistry. One…

Q: Ribosomes that are translating a mRNA, would release that mRNA when they reach a) an operator b) a…

A: Introduction :- Ribosomes have two primary functions: message decoding and peptide bond synthesis.…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: Which of the following best describes the central dogma of molecular biology? O A) MRNA is…

A: Introduction In molecular biology, a central dogma is an illustration showing the flow of genetic…

Q: I wanted to know where in the concepts of genetics 12th edition book can I find the answer to my…

A: The genetic code is a set of laws that define how DNA's four-letter code is converted into amino…

Q: Does a single base-pair substitution in a strand of DNA always result in a new amino acid in the…

A: Transcription is processed to convert DNA into RNA. It is part of the central dogma. It is processed…

Q: How many different single-nucleotide substitutions* (changing one nucleotide to another) in the DNA…

A: The single nucleotide substitutions that can occur to result in a non-sense mutations are -  i) CAA…

Q: What does the future hold for genomes? How will they be different in 100, 1,000, 1 million, or 1…

A: Genome evolution is the term used to describe how an organism's genetic make-up gradually changes…

Q: (a) Which of the following statements is TRUE?     DNA polymerase moves in a 5 to 3 direction in…

A: The biological process by which the information encoded inside a DNA (deoxyribonucleic acid)…

Q: NASA sends a mission to Mars that brings back a new life form!  It is carbon-based and its genetic…

A: Mars is an obvious source of inspiration for science fiction. It is common and well-read, yet unique…

Q: When the human genome sequence was finally completed, scientists were surprised to discover that the…

A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…

Q: How many PAM sequences are present in the sequence below?…

A: Protospacer adjacent motif(PAM) sequence It is a short DNA sequence(usually 2-6 base pairs in…

Q: Why do you think the first part of DNA (deoxyribonucleic acid) is different from RNA (Ribonucleic…

A: DNA or Deoxyribonucleic Acid is a specific molecule which comprises of two polynucleotide chains.…

Q: Why do you think DNA is the genetic material used by eukaryotes instead of RNA?

A: Deoxyribonucleic acid (DNA): Nucleic acids are molecules that store hereditary information for…

Q: What is the evolutionary advantage of genomes?

A: Genome refers to the genetic material of an organism, which consists of deoxyribonucleic acid (DNA).…

Q: If you were to hybridize a eukaryotic gene to its corresponding mRNA, the two molecules would not…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: 6. What is genetic engineering and why does it work? The ProcessO mokingchanges in the pna Code of…

A: Since, of its simplicity and specificity, gene editing has recently become a trend in genetic…

Q: Based on our modern understanding, what revisions are necessary to the original one-gene /…

A: Alternative splicing allows one gene to encode multiple polypeptides: CorrectAlternative splicing is…

Q: Which of the following statements is correct? The prokaryotic ribosomal RNAs are 18S, 23S, and 28S…

A: The objective of the question is to identify the correct statement about ribosomal RNAs and…

Q: What is DNA and RNA? How are DNA and RNA different? Do you think there are any organisms on the…

A: It contains the genetic information for the functioning of the organism. It contains two strands.…

Q: Most of a eukaryotic cell's DNA is found in what eukaryotic organelle?

A: Eukaryotes - Unit membrane-bound sub-cellular structures present. Prokaryotes - Unit membrane-bound…

Q: What is DNA? Provide a 5-sentence long description only.

A: Nucleic acids, large macromolecules are necessary for all organisms and viruses to function. The…

Q: Why is it important to know the length of the dna sequence you digest?

A: In molecular biology, A target DNA molecule is digested by using restriction enzymes, and the…

Q: If only part of the genome contains genes, why sequence the whole thing?

A: The genome is the complete genetic material of an organism.

Q: What is a genome? Describe the following terms/structures as they pertain to a eukaryotic genome:…

A: In genetics, the eukaryotic genome is more advanced than the prokaryotic genome. It consists of…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.