Use the Flex (a fast lexer generator) to generate a lexer. Flex is the tool for generating lexers. Flex implements the algorithm that convert RE to NFA and NFA to DFA for you. So, you only need to write an input source Flex file (filename.I), where you specify a specification of patterns (called rules) of the lexer using Regular Expressions and C code. You are expected to: 1. Describe the skeleton of an input Flex source file (filename.) and their functionalities. Three sections in the file: definitions, rules and user routines.

Could I get an example of a program writen in C that uses qsort() to sort its command line vector argv by the length of the strings? This is part of my first project and I don't understand pointers very well. If you have a video on how it is done that would work too. I looked at the meterial provided to me and I still cant rap my head around it. If this is to big of a question if you could baby step me through how pointers work that would be a great help. Thank you

in C program please

in c++ code

Help with this. Solve the Heads-or-Tails problem in C or C++. Read the H-or-T data from either a file or from STDIN. Reportthe result and related statistics to STDOUT. Report any errors to STDERR:a. In an effort to find something to do during self-quarantine, your friend flips a coin many times andcarefully records the result of each flip in a character vector using either H or T. Write a functionprogram called longestRun that reads these characters from a file and then analyzes them to find thelargest number of consecutive heads or tails. It must return/display two values: (1) the numbercorresponding to how many max consecutive heads or tails were thrown in a row and (2) thecharacter H or T depending upon whether it was Heads or Tails that was thrown the most times. Inthe event of a tie for the longest run, return the character B for both     the text file is  HTHHTTTHHTHHHTHTHTHHHHHTTHHHHHHHHHHHHTTTTTTTTTH

Provide Full C++ Code In this checkpoint, your goal is to find the longest consecutive sequence of a STR (Short Tandem Repeats) in a DNA sequence. The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should…