Use dAMP and dTMP to draw the two monomers together
Q: How many electron(s) is/are required to completely reduce an oxidized cytochrome-c
A: Electrons generated during the oxidation of carbohydrates are carried by electron carriers such as…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: If you want to make 7 L of 1X TGS (Tris/Glycine/SDS Running Buffer) using 8 x TGS stock, how much of…
A: Recall the equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock…
Q: Which method of chromatography would be the most appropriate for separating mixtures of the…
A: Chromatography is a technique used to separate molecules based on their Solubility in mobile and…
Q: You are studying COVID-19 which infects bat cells through an interaction between a lysine residue on…
A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…
Q: The Krebs cycle reaction shown below is catalyzed by __ enzyme and ___ pays for this reaction note…
A: The TCA cycle or Kreb cycle occurs in the mitochondrial matrix. The TCA cycle uses the acetate in…
Q: he human body requires various nutrients which are essential for health and can be obtained from a…
A: Proteins are comprised of amino acids polymer linked by peptide/amide bonds. Fats are insoluble…
Q: Describe how will you dilute a 10X stock solution into 5X, 2X, and 1X, respectively.
A: INTRODUCTION : Diluting a Stock solution - A stock solution is a high or medium concentrated…
Q: Which of the following translocases serves as the central entry gate for cytosolic precursor…
A: A newly synthesized protein in the cytoplasm is transported into the target site through a process…
Q: PLEASE HELP 1. How many chirality centers does ribose have? Identify them.
A: Chirality is a property that is exhibited by molecules that cannot be superimposed on their mirror…
Q: how you should dispose off sodium bicarbonate and does it have a signal
A: Introduction Hazardous waste is waste which has the potentiality to cause various health issues or…
Q: 3.(12pts) What is the ratio of NH4+/NH3 for a 0.5M solution of NH4Cl at pH 9? (The pKa of NH4+ is…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: Glyoxylate cycle allows the conversion of __ to __ in __ A. Glucose ;lipids ;plants B. Lipids;…
A: The primary source of energy for living cells is carbohydrates. The key molecule in the metabolism…
Q: Match the following steps of oxidative phosphorylation in increasing order from beginning (1) to end…
A: Oxidative phosphorylation is the process by which oxidation of NADH and FADH2 by the complexes in…
Q: What charge does a protein molecule have? O neutral O positive O negative O The charge depends on…
A: Diffusion and osmosis are 2 processes that depict the movement of substances from higher…
Q: 1. 2. NaBr 3. H₂O₂ 4. Al₂(MoO4)3 5. AgNO3 Fe₂(SO4)3
A: In one molecule of a compound how many numbers of atoms of each element are present is…
Q: 1. Using Fischer Projection, draw each of the reaction. for the investment phase of Glycolyse 1…
A: Carbohydrates consumed in diet are oxidised via the glycolysis pathway. Carbohydrates are first…
Q: What are the health benefits of squash in a dessert recipe?
A: Squash is a comforting, delicious, and nutritious meal that is a mainstay throughout the autumn…
Q: rue or false 1. Cytochrome p450 is considered to be the “universal oxygenase” 2. In alzheimer’s and…
A: Oxygenases are enzymes that oxidise substrates with molecular oxygen. PD and AD are neurological…
Q: The location of enzymes is important for metabolic pathways. Which of the following enzymes is NOT…
A: Metabolic pathways require enzymes to catalyse their reactions. The pathways that occur in a…
Q: what are the features which set the G protein family of receptors apart?
A: G protein-coupled receptors (GPCRs) are regarded as one of the most extensive families of validated…
Q: 1) Tabulate the differences and/ or similarities of the different kinds of coenzymes and cofactors.…
A: "Since you have asked multiple questions, we will solve the first eight questions subparts for you.…
Q: onsider the following tripeptide: Gly—Ala—Val What is the charge of the primary structure of…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: Citric Acid Cycle Notes? C² 1000 K
A: In aerobic condition, pyruvate in the presence of pyruvate dehydrogenase complex produces Acetyl…
Q: Which of the following substances is involved in de novo synthesis of purine nucleotides but not…
A: Metabolism is the sum total of all chemical transformations taking place within an organism. Most of…
Q: ОН, 5. CH OH ОН Ч О Ь CH2OH OH O OH V ОН он тор. В. гапо меч, disaccharide A ОН Redo. A) List the…
A: Carbohydrates are classified as monosaccharides, oligosaccharides, and polysaccharides based on…
Q: Identify the structures a-d. (a) (b) (c) (d)
A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…
Q: Which of the following are the precursors in synthesizing myristic acid? a. 7 malonyl-CoA b. 3…
A: Myristic acid is a common fatty acid. It has 14 carbons. Its molecular formula is CH3(CH2)12COOH. It…
Q: How do enhancers differ from promoters? Enhancers do not bind RNA polymerase. Enhancers include the…
A: Transcription requires an enzyme called RNA polymerase that catalyses the transcription. Prokaryotic…
Q: Some enzymes are used in the clinical lab to diagnose diseases. There are two specific markers for…
A: Lactate dehydrogenase (LDH) catalyses the following reaction: Lactate + NAD+ ↔ Pyruvate + NADH + H+…
Q: Coenzyme A is: A) a form of cellular energy. OB) an anabolic electron carrier. C) a catabolic…
A: Cells convert energy into small, energy-rich molecules such as ATP and nicotinamide adenine…
Q: draw a guanine nucleobase and label all possible H bond donor and H bond acceptor?
A: H bond donor are those groups containing a H bonded to a electronegative atom (F,O,N) and H bond…
Q: The hormones insulin and glucagon play an important role in the regulation of plasma glucose. a)…
A: Our body primarily uses glucose as a source of energy. In order to carry out the normal functions of…
Q: .Here is an oligomeric protein, which has two binding sites: 1)Write the formulas of side chains of…
A: Oligomeric proteins are quaternary structure proteins which possess more than one subunit of…
Q: Give 10 examples of enzymes that use NAD/ NADH and NADP/ NADPH and their functions.
A: NAD/NADH and NADP/NADPH act as intermediates in several biochemical reactions. NAD+/NADH and…
Q: 1 Describe the difference between amylose and amylopectin. 2 what is the monosaccharide that…
A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Circle the functional groups on the R-group of the AMINO ACIDS below that are capable of forming…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: Age-related macular degeneration (ARMD) within the eye is a disease that is closely related to…
A: Age-related macular degeneration (ARMD) is an ocular disease causing damage to the retinal macula,…
Q: You have purified a recombinant form of the p53 protein from E. coli and determined the A280 to be…
A: Beers law states that the absorbance of a sample depends on the amount of sample present and path…
Q: In order to activate glucose for storage as glycogen, what must be added to each glucose? A)…
A: Glycogen is a branched glucose polymer that is used as an energy reserve in animal cells. The…
Q: QUESTION 21 Match the following metabolic reactions or components with their corresponding cellular…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Which of these is not a suitable test for assessing folate status? red cell folate plasma…
A: Folate formerly known as folacin is a water soluble vitamin B or B9 usually found in some foods…
Q: For Asp-Cys-Lys-Arg, What are the pH buffering regions (pH range)? Charge at ph 4?
A: Peptides are made up of amino acids. Every amino acid have an alpha-carbon that is bonded to 4…
Q: Calculate AG for ATP hydrolysis in muscle at 16 °C. Use the muscle concentrations from the first…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: Which of the following is NOT a true statement about the diagram below? Intermediate A Pathway…
A: Enzymes are the biocatalysts that mediate the biochemical reactions of metabolic pathways. They have…
Q: 5. Explain in quantitative terms the circumstances under which the following reaction can proceed in…
A: Positive delta G means that the reaction cannot occur spontaneously. If delta G is negative then it…
Q: What is the main source of energy for ATP replenishment for ATP-PC system
A: ATP is produced by either substrate-level phosphorylation or oxidative phosphorylation Hydrolysis of…
Q: Which of the following is an allosteric activator of mammaliah carbamoyl phosph synthetase? OA)…
A: Introduction Carbamoyl phosphate synthetase is an enzyme that has 3 different forms. Carbamoyl…
Q: Complex 2 oxidizes ___ and reduces __ a. FAD, COQ b. COQ , Cytochrome C C NADH, COQ d.…
A: Aerobic metabolism of 1 molecule of glucose can produce 10 NADH (6 from acetyl CoA in TCA cycle + 2…
Q: The hormones insulin and glucagon play an important role in the regulation of plasma glucose. b)…
A: Insulin (release from the beta cells of pancreas) and glucagon (release from the alpha cells of…
Step by step
Solved in 3 steps with 4 images
