True or false. The speciation of ratites into different lineages including emus, cassowaries, ostrich, and kiwi, among others is a result of dispersal.
Q: Which of the followings is CORRECT about osmosis of water? Water will move through equally O…
A: As we know that most abundant substance of the living cell is water .It is essential for all the…
Q: A. The single-stranded RNA would complement the target RNA. B. Gene expression is inactivated once…
A: Cell has many enzymes which help the cellular activities while other enzymes negatively regulate…
Q: 5. Larry and Lola Little have achondroplasia, a form of dwarfism. Both are heterozygotes. Their son,…
A: Heterozygous condition is defined as a condition in which two variations of a gene known as alleles…
Q: Why does carbon dioxide need to be transported in the form of bicarbonate ions? because it is…
A: Because bicarbonate is an alkali, it aids in maintaining the body's acid-base equilibrium. The…
Q: cytosines are methylated most frequently in CG regions in the DNA
A: Cytosine is one of the four nucleo-bases found in the DNA and RNA, along with adenine, guanine, and…
Q: 21. During which phase of the cell cycle does DNA synthesis take place? A. Anaphase B. Metaphase C.…
A: A cell cycle is a series of activities that take place within a cell as it grows and divides. The…
Q: friend tells you the following story. "My aunt just received a heart transplant. Her doctors warned…
A: * Here a friend tells that his aunt received heart transplant and doctors warned her body might…
Q: List the four traits that define chordates.
A: Chordates include all those animals that contain vertebral columns and they belong to the phylum…
Q: formation of different cellular phenotypes is due to the equal distribution of the cytoplasmic…
A: Phenotype shows the appearance of individual. genotypes shows the genetic type.
Q: Prions (a) consist of RNA with no protein coat (b) are misfolded proteins (c) cause several…
A: A prion is described as a type of protein that has the ability to trigger the normal proteins that…
Q: In the series "Lost" 20 individuals crashed on a deserted island. One of the many alternate…
A: The given situation is an ideal situation of the Hardy Weinberg Equilibrium. As per the data…
Q: Describe the anatomical and physiological adaptations that aroseduring the transition to life on…
A: Life evolved underwater so the earth was totally covered with water at the beginning of humankind,…
Q: Among living animals, only birds have_____ . a. a cloaca c. feathers b. amniote eggs d. a…
A: Introduction :- The tissue that will become the female fetus's intestinal, genital, and urinary…
Q: 5.Statement 1: The cell-mediated immune response is brought about by T cells. Statement 2: In…
A: Statement 1: The cell-mediated immune response is brought about by T cells This statement is true.…
Q: 3. Chronic alcoholism damages the liver. In people who have alcohol-induced liver damage, the blood…
A: Introduction Excess fluid trapped in your body's tissues causes edoema, which causes swelling.
Q: Compare satellites, viroids, prions, and defective interfering particles (DIPs).
A: Subviral agents include satellites, viroids, prions, and defective interfering particles (DIPS).…
Q: 1. Stress can affect the epigenome of an individual. II. Depending on the affected site, epigenetic…
A: Stress can have a direct effect on DNA through the mechanism of epigenetics, which means 'on top of…
Q: 1. Identical twins may show dissimilar phenotypes due to changed methylation patterns of the…
A: * monozygotic twins even they are genetically identical there will be some variation in them the…
Q: Describe the effects of streptococcal haemoysins giving an example of streptococci that can manifest…
A: A "microbe" is a living entity that is so tiny that it cannot be seen with the naked eye.…
Q: True or false. The separation of populations due to the emergence of barriers is referred to as…
A:
Q: Which of the following definitions are consistent with the scientific meaning/use of the word…
A: A research proposal is a document that defines the objectives of the research as well as the methods…
Q: Neutrophil is a common White blood cell present in blood and the percentage of presence is: O 15% O…
A: Neutrophils are the most numerous white blood cells and it is an important part of our immune system…
Q: What molecules are released by activated helper T cells? Note: This is a multiple question, choose…
A: As they are necessary for practically all adaptive immune responses, helper T cells are perhaps the…
Q: If the tobacco plant parents are both heterozygous for color, what are the possible genotypes and…
A: INTRODUCTION Phenotype : physical appearance of an organism. Genotype : Genetic makeup of an…
Q: A commercial stage micrometer has a total length of 1000 μm and is divide into 100 equal divisions.…
A: Introduction Meiosis is the cell division process that results in the formation of egg and sperm…
Q: In 1798, a stuffed platypus specimen was delivered tothe British Museum. Reports that it laid eggs…
A: Amniotes are described as the vertebrates that have a tendnecy to develop embryo in the amnion.…
Q: Which type of circulation ensures enough oxygenated blood will be supplied to the different parts of…
A: Introduction Circulatory system:- It is the system that contains the heart and the blood vessels and…
Q: None of the above Which of the following is amphipathic? O Phospholipids. O Integral proteins. O…
A: Introduction : Membrane lipids are amphipathic in nature. It has polar head and non polar tail.…
Q: Tetrapods evolved from_______ . a. sharks c. lobe-finned fishes b. teleosts d. placoderms
A: All extant and extinct creatures that evolved from the last single ancestor of amphibians, mammals,…
Q: What would happen if the polydnavirus mutated and no longer depressed the caterpillar’s immune…
A: Polydnavirus is a kind of insect virus belonging to the polynaviridae family. This virus can form a…
Q: different kinds of waste produced in a Nuclear Medicine Department. What are the appropriate…
A: Nuclear Medicine Department The nuclear medicine department is that branch of science and medicine…
Q: 3. One indication of the relative importance of various ATP-producing pathways is the Vmax of…
A: I gave you the answers below.
Q: E ion A formula for a cough syrup contains 1/9 gr of codeine phosphate per teaspoonful. How many…
A: 1 teaspoon= 5 ml 1.5 pint = 852 ml cough syrup contains 179 gm of codeine phosphate per…
Q: metabolize aerobically and anaerobically. refers to pathways that take place in the presence of…
A: The human body needs glucose to make adenosine triphosphate (ATP) molecules during the aerobic…
Q: Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’…
A: Template DNA: 5’ATGACGGAATATAAGCTGGTGGTGGTGGGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’…
Q: A bacterial culture contains 500 cells/mL in the exponential growth phase at 8 AM. If you onsider a…
A: Generation time is the time taken by bacteria to double their population. Here the given generation…
Q: Marsupials
A: Mammals- an animal that breathes air, has a backbone, and grows hair at some point during its life…
Q: RNAi (or RNA interference) is the process of creating double-stranded RNA in the cells. Explain how…
A: * RNA interference (RNAi) also called as Post Transcriptional Gene Silencing whi h is an conserved…
Q: Dideoxy sequencing is one of the most important methods for DNA sequencing. What could be the impact…
A: The biological methods for establishing the arrangement of the nucleotides in a DNA oligonucleotide…
Q: the cytoplasmic membrane is universally similar across the three Domains of life. Discuss this…
A: The cell membrane (also known as the plasma membrane (PM) or cytoplasmic membrane) is a biological…
Q: 5. In corn plants, a dominant allele I inhibits kernel color, while the recessive allele i permits…
A:
Q: 2. An atrial septal defect is a birth defect in which there is an opening in the septum between the…
A: Introduction The cause of an atrioventricular septal defect is unknown. An atrial septal defect is a…
Q: Natural Selection A Process of Evolution It wasn't until the year 1800 a man named Jean-Baptiste de…
A: Answer
Q: Infer how COVID19 RNA might be replicated in human cells. Use the following RNA sequence (the sense…
A: RNA-Seq (acronym for RNA sequencing) is a sequencing technology that employs next-generation…
Q: A woman who is colorblind (XcXc) can expect 50% of her male offspring to be colorblind. 100% of her…
A: Introduction Color blindness is a condition in which you view colours differently than most people.…
Q: the diploid somatic nucleus of xenopus has 900 copies of rDNA and in the mature oocyte it could…
A: Transcription is a process in which DNA is converted to RNA.
Q: How do viroids and prions differ from viruses?
A: A virus is a small infectious agent which replicates only within an organism's live cells. Viruses…
Q: rections: Create a concept map of homeostasis by filling out the white-filled xes. Afterwards,…
A: Homeostasis It is defined as a process used by living organisms to maintain the optimal functioning…
Q: 14.Which is an air sac that surrounds the lung capilliaries? Read and analyze the question and…
A: Bronchus is basically the wind track that leads to the lungs from trachea. So this can't be the…
Q: Understand how a cancer cell from a primary benign tumor is able to leave the primary benign tumor…
A: Cancer metastasis is the spread of cancer cells to tissues and organs beyond where the tumor…
Step by step
Solved in 2 steps
- True or false. Dispersal or vicariance may possibly lead to isolation and further to separation of lineage from their ancestral lineage or speciation.Considering the human dispersal pattern. given what you knw about the founder effect, would you expect populations native to south america to be more or less genetically diverse than those native to asia? explain your reasoning.TRUE OR FALSE? The interdependent evolution of similar organisms whose members freely interbreed in the wild is called coevolution
- Theory of Evolution. Please answer all question that is just one sentence each question. PART 2 1. Why is it necessary for you to include the effects of natural selection in your biodiversity report? 2. How will species adaptation and populations affect your part of the study? 3. What predictions can you make with regards to the population, adaptation, and natural selection of your selected area? 4. What lead you to reach these predictions? 5. What methods will you use to determine and analyse the population and evidence of adaptation/natural selection?Part B- Phylogenetic trees and geographic relationships The island fox, Urocyon littoralis, is endemic to the Channel Islands, which are located off the coast of southern California, Six of the eight Channel Islands support fox populations, and each of these islands is home to a distinct subspecies, as shown in the table below. Island Subspecies Santa Cruz santacruzae Northern Chanel Islands Santa Rosa U. I. santarosae San Miguel U. I. littoralis San Nicolas U.I. dickeyi Southern Channel Islands San Clemente U.I. clementae Santa Catalina U.I. catalinae The island fox shares a common ancestor with the gray fox. Urocyon cinerecargenteus, which is found on the mainland. Both species have similar coloration and a diploid chromosome number of 66. One structural difference between the two species is the reduced size of the island fox, a feature known as dwarfism. The various island subspecies also differ from each other in size, number of tail vertebrae, and other characteristics The…To explain: one or more possible explanations for the slower rate of evolutionary change in the human lineage versus the rat lineage.
- Sympatric, allopatric and parapatric speciation, which is considered the (far) more common mechanism of species formation.Phylogenetic with branch lengths scaled in genetic distance 0.88 0.88 0.93 0.78 2388-3883 232 2002 4⁹29930 9823-2883 0.8 0.82 0.89- Mycobacterium tuberculosis Lineage 2 0.99 2001 90-2004 4484 2005 -0.635 388627805 718356883 11 2002 -83331-9811 74333-2690 $250-2010 10737 2002 203 2001 1511 208201 4701810 2008-2011 6295 29889 8073_2007 0.01 (# substitutions/nucleotide site) 83922889 015 2005 98507_2009 8195 200 46828000 Root-to-tip distance Evolutionary distance from root-to-tip versus sampling time 2.8x10 2.2x10 R²=0.00 1990 1995 2000 00 000 80 2005 000 O oo XBOO8 1. In this figure you can see a phylogenetic tree of samples of Mycobacterium tuberculosis lineage 2 and a corresponding root-to-tip plot. The branch lengths in the tree are scaled by evolutionary/genetic distance, so not by time. In the plot on the right, the summed branch lengths going from the root to the tips of the trees are then plotted against the dates the tips were sampled. What can we conclude from these figures? The…True or false? The biological species concept distinguishes two species based on the degree of genetic exchange between their gene pools
- two color variations: bright blue and bluish-gray. Bright blue coloration is a recessive condition that is rare in the original population (less than 5% of the birds have the trait). A small flock of 5 wrens is blown by a storm onto a new island that is 100 miles away from their old home. 3 of the 5 birds were blue-gray and the other 2 were bright blue. This new population thrives on the island as it is the only bird species present on an island with lots of food and no predators to hunt them. Over the next 10 years, the 5 birds and their descendants reproduce and populate the island, creating a population that is made up of about 40% bright blue wrens. later, a hawk species is blown over to the island. This hawk hunts the smaller wrens using its excellent vision. The bluish-gray birds blend in better with the landscape compared to the bright blue birds. Name the specific mechanism of microevolution that the wren scenario displays when they were first blown over to the new…logy Practice #2 x Question 1 Changes in the Florida Panther Population Florida panthers are a subspecies of cougars that live in the wetlands and forests of southern Florida. They are strict carnivores. Their diet consists mostly of deer, wild hogs, and livestock. Florida panthers need a large habitat in order to successfully hunt, reproduce, and raise their young. During the last century, the Florida panther population has experienced habitat fragmentation due to the construction of roads, urbanization, mining, and agriculture. This fragmentation has led to an increase in inbreeding within their population. Inbreeding occurs when closely-related animals mate and produce offspring. Inbred animals have a higher risk of inheriting genetic diseases, which often reduces their survival or ability to reproduce. To conserve the population of Florida panthers, a team of scientists introduced eight Texas panthers to Florida in 1996. Texas panthers are a closely related subspecies of cougars.…Select all that apply. Beetles from two geographically isolated populations are captured and brought to the lab. When an adult male from one population and an adult female from the other population are placed together, they mate, and the female lay eggs a couple of days later. The eggs hatch, the beetles develop into adults but are sterile. Which of the following are true? This is an example of post-zygotic reproductive isolation. O Sexual selection is likely responsible. O This is an example of pre-zygotic reproductive isolation. O Dobzhansky-Muller genetic incompatibility is likely responsible. Question 3 Choose all that apply. Which of the following are true of adaptive radiations? OAdaptive radiations involve relatively rapid speciation. The evolution of the Hawaiian silverswords is an example of an adaptive radiation. OAdaptive radiations can occur when an ancestral species colonizes a new arca and adapts to multiple open niches. Question 4 What are the three major steps of…