Q: The mechanism of activation of eukaryotic genes involves addition and removal of phosphate residues…
A: The eukaryotic system has a general trend of activating anything by phosphorylation and vice versa.…
Q: Which statement about energy flow in ecosystems is accurate? A.Energy flow reaches an equilibrium…
A: Environmental science is one of the sciences that we must learn that every living thing on this…
Q: What are the primary and the secondary constrictions of a chromosome? What is the other name given…
A: Chromosome At the time of cell division the chromatin material get condensed to form chromosomes…
Q: In order for transcription to begin, the DNA-duplex must be "opened" to allow RNA polymerase access…
A: RNA polymerase is an enzyme found in the nucleoplasm of nucleus. It is involved in the…
Q: Partial 0.75 /1 pts Question 8 Where is carbon stored on Earth? Check all that apply. V rocks and…
A: Carbon is one of the most important elements to humans since all organic compounds and most…
Q: 3. Compute for the amount of each component of KCN broth if you were to prepare 280 ml. Express your…
A: KCN/Potassium cyanide broth is mainly used to differentiate the members of Enterobacteriaceae family…
Q: Is salamander more closely related to shark or human? shark salamander lizard armadillo human C В A…
A: Cladograms - is a tree like structure that shows how organism are related. In a cladograms, the…
Q: (c) Draw the absolute configuration of Cholesterol. How Progesterone can be synthesized from…
A: Basic nucleus of cholesterol is formed by a sterol nucleus. This sterol nucleus is made of four…
Q: Q.1. Enumerate the post-transcriptional modifications in a eukaryotic mRNA.
A: There are 3 post-transcriptional modifications which are splicing, capping and tailing. The…
Q: Hydrophobic and hydrophilic: how do aquatic insects locomote on the surface of water?
A: Hydrophilic and hydrophobic The word Hydrophilic is a combination of two words i.e. "Hydro" which…
Q: Give and explain at least (5) five simple habits you can adopt that may reduce the risk of problems…
A: 1. Stay hydrated- Drink as much water as you can. Drinking proper amount of water keeps urinary…
Q: Which of the following Is true of the leading strand? A it is synthesized discontinuously at the…
A: Leading strand is synthesized continuously and lagging strand is synthesized discontinuously. Both…
Q: Which cell secretes the matrix for bone formation? a) Osteoclastoma b) Osteoclast c) Mesoblasts d)…
A: Introduction :- The bone matrix is the component of the bone tissue that makes up the majority of…
Q: A 3-point test cross produces the following numbers of offspring: + + a 348 How many double…
A: Test cross is a cross made between f1 (offspring)with its recessive parent to identify the dominance…
Q: In bacteria, the ___consensus sequence of mRNA binds to the ____rRNA of the 30S small subunit during…
A: * Translation is the process in which genetic code is present in a messenger RNA molecule is decoded…
Q: Evolutionary Sciences ask: O "Why" questions O "What" questions "How" questions O "When" questions
A: The main function of evolutionary scientists is how the today's organisms evolved into the current…
Q: The signaling pathway in mammalian cells that senses low oxygen inhibits the activity of the…
A: Animal cells produce ATP by cellular respiration, whereas plant cells produce carbohydrates through…
Q: During alveolar HYPERventilation, levels of blood CO2 drop while blood O2 is elevated. What…
A: Alveolar hyperventilation- Alveolar hyperventilation is a disorder where it leads to decreased…
Q: Optimal DNA replication requires the coordinated effort of all the following EXCEPT: A single strand…
A: Single stranded binding proteins prevent single stranded DNA from exonuclease activity during…
Q: Please Give a clear explanation handwritten answer.
A:
Q: Adaptive radiation is when populations diverge from a common ancestor into new species,each of which…
A: Adaptive radiations is an evolutionary pattern whereby a single ancestral form diversifies os…
Q: Which of the following is true about neglected tropical diseases? Group of answer choices Though…
A: * Neglected Trophical disesase commonly seen in countries like Africa and Asia and Latin America…
Q: All herbivore species are small such as insects and would not be able to have massive muscular…
A: * Herbivores are organisms that feeds on plants and they can range in size from tiny insects like…
Q: .Define autosome, hemizygous, homozygous, and heterozygous?
A: Genes Genes are basic unit of heredity. They are present on the DNA.
Q: 1. Why has the hoatzin earned the nickname, "stinkbird? 2. Hoatzin chicks have unusual features…
A: As per Bartleby guidelines experts area allowed to answer only 3 sub-parts for given question.…
Q: Spongy bones do not have a haversian system. a) False b) True
A: Introduction - Compact bone is more dense and lighter than spongy (cancellous) bone. Plates…
Q: 3. Listed within this chart are descriptions of a variety of DNA mutations. Your job is to fill in…
A: *Mutations cause change in DNA sequence thar are resulted from DNA copying errors during cell…
Q: Match the following structures with their functions a. blood clotting b. matrix of blood and…
A: Human body is a complex machine required in many processes to function efficiently. To keep these…
Q: This figure can be used to represent the sequence of events leading to the evolution of dark-furred…
A: Evolution is the change in the characteristics of a species over several generations and relies on…
Q: The principal DNA polymerase in eukaryotic leading strand DNA replication is: A DNA polymerase B…
A: * DNA polymerase catalyze the synthesis of DNA molecules from precursors of DNA which are essential…
Q: Which cell secretes the matrix for bone formation? a) Osteoclastoma b) Osteoclast c) Mesoblasts d)…
A: Introduction - The creation of bones is known as osteogenesis or ossification. Following the…
Q: Rain falls on a fertilized agricultural field after a farmer has harvested the crop. Which…
A: Macronutrients of plants include Carbon, Nitrogen, Phosphorous along with the role of water. In…
Q: Explain rna splicing in eukaryotes
A: The "translation" is the process through which mRNA codes for a certain protein. The ribosome…
Q: Darwin based his Theory of Evolution by Natural Selection on series of observations. Which of the…
A: In today's world when a pandemic spreads those who have strong immunity could survive and could be…
Q: Which of the following regions on the tRNA are composed of a sequence of nucleotides? a. anticodon…
A: The tRNA is responsible for transferring amino acids at the site of translation or protein…
Q: The enzyme that removes the RNA primer from the Okazaki fragment is: A DNA ligase B DNA gyrase (c)…
A: The double standard DNA molecule is produced by the action of DNA volume range and the process…
Q: Why do acentric fragments get lost?
A: Introduction :- A chromosomal segment with no centromere is known as an acentric fragment.Acentric…
Q: explain also.
A: PABP (Poly A binding protein) is a RNA binding protein which triggers the binding of eukaryotic…
Q: What are the species of anaerobic bacteria which can be found in chronic wound?
A: Introduction Anaerobic bacteria are bacteria that do not live or grow when oxygen is present or that…
Q: Briefly discuss Mendelian Inheritance with that of crossing-over.
A: The Mendelian genetics gives us idea about the inheritance of genetic materials from the parents to…
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: Why is Trisomy 21 more common than other trisomies (e.g. Trisomy 1, Trisomy 2, etc.)? The size of…
A: Answer :-(C) Trisomy 21 are caused by nondisjunction, which occurs when pairs of homologous…
Q: Column A Column B Column C I. a. Spherical/globular A. Epithelial I. b. Striated, multinucleated,…
A:
Q: energy flow differently in island pyramids vs landscape pyramids? Is the recycling of matter more…
A: The pyramid of energy depicts the flow of energy from one trophic level to another trophic level. It…
Q: As a Dentistry student, what do you think is the importance of studying all the cranial nerves.
A: The cranial nerves are a group of 12 nerves that run along the back of your head. They also assist…
Q: An advantage of gas exchange in water, compared with gas exchange in air is that water usually…
A: Gas change is the process by means of which oxygen and carbon dioxide flow among the bloodstream and…
Q: Okazaki fragments are short DNA pieces that explain how
A:
Q: Summarize the major scientific findings about human sexual desire, arousal, and response.
A: The human sexual response cycle is a set or sequence of physical and emotional changes that occur…
Q: need a good answer.with explanation.Thanks 1- Which of the following species appeared earliest in…
A: 1- Which of the following species appeared earliest in the fossil record? Choices ( Homo…
Q: 1. The group of Leonor and Junior conducted an experiment about the fragmentation of planaria.…
A: In this, the given paragraph includes the experimental process and the observations of…
Genetic Variation
Genetic variation refers to the variation in the genome sequences between individual organisms of a species. Individual differences or population differences can both be referred to as genetic variations. It is primarily caused by mutation, but other factors such as genetic drift and sexual reproduction also play a major role.
Quantitative Genetics
Quantitative genetics is the part of genetics that deals with the continuous trait, where the expression of various genes influences the phenotypes. Thus genes are expressed together to produce a trait with continuous variability. This is unlike the classical traits or qualitative traits, where each trait is controlled by the expression of a single or very few genes to produce a discontinuous variation.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Forms and Expressions of Alleles Classify each of the following phenotypes and genotypes using the vocabulary from this lesson. Phenotype Brown eyes/ Genotype one dominant brown allele and one Phenotype Blue eyes/Genotype two Phenotype Brown eyes/Genotype two recessive blue alleles dominant brown alleles recessive blue allele :: ::: ::: homozygous recessive homozygous dominant heterozygous Save Submit Google Chrome edu DELL 4 7 8. 9. tw #***18. Complete this flowchart to show how different alleles can result in different characteristics. In the DNA, different alleles of a gene have a different sequence of > different sequence of transcription > different sequence of in a protein translation > different structure and function of the protein (e.g. normal enzyme vs. defective enzyme) > different characteristics (e.g. normal color vs. albino) inRecessives Allele, an allele that is fully expressed in the phenotype of a heterozygote. Select one: True False
- True or false: In a heterozygous individual, the phenotype will reflect the dominant allele trait.True or False: It can be considered that mutations are cause for both disease and evolutionary change in providing variations in alleles.Imagine you have a blood group of "X" which is recessive and expressed by xx. The dominant blood groups are Y and Z, where homozygous of these alleles are expressed as YY and ZZ, respectively. What will be the genotype of your parents blood group? Why? Please explain in your own words. [Max 200 words]
- Punnett Square Activity: Directions: You find out that having a thumb that can bend back (e.g. hitchhikers thumb) is a recessive trait in humans. Your female friend Anna, who has a hitchhikers thumb, is about to have a baby with a male partner, Jose, who does not have a hitchhikers thumb, although one of his parents does have hitchhikers thumb. Anna wants to know how likely it will be that her children will have a hitchhikers thumb. Use capital 'H' to represent the dominate allele and lower case 'h' to represent the recessive allele. 1. What are the genotypes of Anna and Jose? a. Anna b. Jose Hitchhiker's thumb No hitchhiker's thumb 2. Fill out the Punnett square below using Anna and Jose's genotypes: Anna's Genotype Jose's GenotypeThe ABO blood group has three different alleles: F, P, and i. The genotypes and phenotypes (blood types) for different combinations of the three alleles are shown the table. Possible Genotype and Phenotypes of ABO Blood Group Phenotypes Genotypes (Blood types) AJA or Ai Type A Type B |Туре О Type AB B|B or 1Bi AJB What percentage of offspring from a cross between a homozygous Type A parent with a heterozygous Type A parent is expected to contain the i allele? O A 25% O B. 50% Ос. 75% O D. 100% acerHeight is a polygenic trait. These students in a genetics class lined up, with shorter individuals on the left of the photo and taller individuals on the right, display a classic bell-shaped distribution. © McGraw-Hill Education/Photo by David Hyde and Wayne Falda
- Can you curl your tongue? Tongue-curling in humans (T) is a dominant genetic trait. Derek can curl his tongue but his wife, Ashley, cannot. All nine of their children can curl their tongues. Complete the Punnett square based on the genotypes they most likely have.In a monogenic genotype, the frequency of a homozygous wild type trait is 64%. What is the frequency of a homozygous mutant genotype? Show your work.The phenotypes of individuals that are homozygous dominant and heterozygous for a gene with two alleles, one dominant and one recessive, will be the same. True False