Answered: Transcription factors a. help the RNA…

Name: Transcription factorsa. help the RNA polymerase bind DNAb. are involve
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Transcription factorsa. help the RNA polymerase bind DNAb. are involved in chromatin remodeling, uncoil the DNAc. modulate transcription from the distanced. add the 5’ CAP to the RNA

Science

Biology

Transcription factors a. help the RNA polymerase bind DNA b. are involved in chromatin remodeling, uncoil the DNA c. modulate transcription from the distance d. add the 5’ CAP to the RNA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Please help me to answer the TRANSCRIPTION PROCESS: 1. Briefly describe the synthesis of mRNA in the transciptuon process 2. Write the base sequence for the mRNA that would be formed during transcription from the DNA strand with the base sequence GCCATATTG. Thank you very much for your help.
F. RNA TRANSCRIPTION AND GENE EXPRESSION 1. The template strand of a segment of double-helical DNA contains the sequence (5) СТТААСАССССТGAСТТСGCGCCGTCG (3') What is the base sequence of the mRNA that can be transcribed from this strand? b. What amino acid sequence could be coded by the mRNA in (a), starting from the 5' end? а.
Part II. Transcription as a Process 4. Use the below "transcription bubble model" of a gene during the process of transcription to do following: • Label the 3' and 5' ends of all polynucleotides appropriately • Label the mRNA transcript • Label the template strand HillT لليليلا UFUP 5. What protein is responsible for making the "bubble" in the DNA shown above?
Sources of Variability 1. If a point mutation occurred so that adenine was changed to thymine in the amino acid triplet code CTA, what would the resulting amino acid be? 3. What is the complementary DNA code for the following base sequence (from a section of DNA)? ATG C C C G G C CT TATTTTCTACA TGGT b. What is the complementary mRNA code? c. What is the tRNA code for this sequence? ACTT
. Locate the -10 region hexanucleotide sequence in the following coding strand of DNA. Indicate the region of the RNA polymerase initiation site. AATTGGGATCCCTATAATGCGCCTACGTTGAGACGAGTGGACGC
A gene is about to be transcribed. Draw a cartoon/ diagram of double stranded DNA that contains this gene, and indicate where in this DNA corresponds (or will correspond to after transcription): promoter, 4 exons, 4 introns, start of transcription, start of translation, start codon, and stop codon.
To initiate transcription. binds to a specific v called the , located at the 5' end of a gene. DNA polymerase RNA polymerase leading strand A Moving to another q lagging strand sponse. primer primase promoter DNA sequence RNA sequence enhancer
II. A double-stranded DNA molecule with the sequence shown below can produce a polypeptide that is four amino acids long. Identify which DNA strands are the coding and the transcribed template strands by circling C or T to the left of the table below, respectively. Use an arrow to indicate the direction of transcription. In the table, show the mRNA sequences and amino acids in this peptide. In spaces to the left and right of the table, label all 5' and 3' ends of all relevant nucleic acid strands. READ CAREFULLY: The table gives you the possibility of filling in answers that show transcription from either strand or in either direction. You are only required to fill in the information relevant to ONE PEPTIDE (no others). Refer to the genetic code on the following page. HINT: While we read and write in 2D from left to right, in the 3D world of a cell there is no such restriction on reading and writing associated with transcription or translation. AA mRNA TCA CGG AAT TTC TAG CAT GTA C or…
D. Fill in the table below. Determine the correct template and coding strands to properly answer this. _C_ A T_C AT -GT DNA double helix T__ _T_ CA mRNA __A GC_ tRNA anticodon Polypeptide AC GCA Trp G C (Stop)
. The table opposite shows the standard (coding strand) DNA winlet codes for the 20 amino acids involved in protein synthesi A section of DNA template strand is shown below. 5'-CATCCAAATTGTTGCCCG-3' (a) Write down the sequence of amino acids formed when ti section of DNA is transcribed and translated.
Date: Class: Name: Transcription Questions Answer the following questions. 1. What bases are found in RNA? 2. What bases are found in DNA? 3. Which strand is the messenger RNA complementary to? 4. Which strand is the messenger RNA nearly identical to? 5. What proteins help to direct the RNA Polymerase to the right location? 6. The end of a new nucleotide is always added to the end of an existing strand. 7. Distinguish between the following two terms: chromosome and gene. 8. Scientists have long referred to the DNA between genes as "junk DNA". But as scientists study the genome, they discover new and unique reasons why this DNA is not really "junk". Using internet resources, research 2 functions for sections of DNA in between genes. Describe your findings below. C) 2015 Bethany Lau.
Reading frame Frameshift Initiation factors Elongation factors. Release factors E III III III III Proteins that bind to a nonsense codon on mRNA and halt translation. Tagging defective proteins with 3 or more ubiquitins will target it for destruction. Destroys defective proteins that have been polyubiquitinated. A reversion of a mutant back to wild type function. A mutation such as an indel that shifts the triplet reading frame to a different series of nucleotides altering every downstream codon from that point onward. Open in P