d. the way nucleotides are paired in the two strands of a DNA molecule 6. Watson and Crick first built a triple-helix model of DNA. In this model, the nitrogenous bases were on the outside of the DNA molecule, and the phosphate groups were on the inside. a. At that time, why did it seem reasonable for the bases to be on the outside of the DNAmolecule? b. What evidence caused Watson and Cick to revise this model? Give specific examples from the film. 7. Table 1 contains data that Erwin Chargaff published about the composition of DNA. Table 1. Proportions of nitrogenous bases in the DNA of different organisms. Data from Chargaff and Davidson (1955). % Thymine 32.9 32.1 28.4 29.4 Tissue % Adenine Guanine Organism Yeast Sea urchin Cytosine 17.1 31.3 18.7 32.8 17.7 |21.4 19.9 Sperm 18.4 Rat Bone marrow 28.6 21.5 Human Thymus Sperm 30.9 19.8 Human 30.3 19.5 19.9 30.3 a. Compare the composition of the DNA in the different organisms. Describe any similarities or differences you observe.

d. the way nucleotides are paired in the two strands of a DNA molecule 6. Watson and Crick first built a triple-helix model of DNA. In this model, the nitrogenous bases were on the outside of the DNA molecule, and the phosphate groups were on the inside. a. At that time, why did it seem reasonable for the bases to be on the outside of the DNAmolecule? b. What evidence caused Watson and Cick to revise this model? Give specific examples from the film. 7. Table 1 contains data that Erwin Chargaff published about the composition of DNA. Table 1. Proportions of nitrogenous bases in the DNA of different organisms. Data from Chargaff and Davidson (1955). % Thymine 32.9 32.1 28.4 29.4 Tissue % Adenine Guanine Organism Yeast Sea urchin Cytosine 17.1 31.3 18.7 32.8 17.7 |21.4 19.9 Sperm 18.4 Rat Bone marrow 28.6 21.5 Human Thymus Sperm 30.9 19.8 Human 30.3 19.5 19.9 30.3 a. Compare the composition of the DNA in the different organisms. Describe any similarities or differences you observe.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Similar questions

A. Draw a detailed structure of DNA strand using the following sequence of bases 5'A -C- G 3' Show the structure of the phosphate group, pentose sugar and nitrogen containing base B. Why is DNA called the blueprint of an organism?
a. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to it so that the complementary bases are side by side. Connect the appropriate base pairs. b. Sticking to the convention of writing the nucleotide sequence in the 5'-3' direction, what is the nucleotide sequence of the DNA strand complementary to ATGCACCATGCT?
Which statements reflect the Watson-Crick model of DNA? Select all that apply. The strands of DNA run in the same direction. Two helical DNA strands are coiled around a common axis, forming a right-handed double helix. The sugar-phosphate backbone lies outside of the helix. The diameter of the helix is 30 Å. The purine and pyrimidine bases lie outside of the helix.
A. In the product, the underlined regions are called what? B. What functional groups are present in the highlighted 5' and 3' ends of the DNA products?
A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the parent DNA (3' to 5') strand correspond to a start codon and its last three nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it down as follows: a. the sequence of parent DNA (template) 3' A C A TT 5' 3' Upon undergoing DNA replication, show what one daughter DNA molecule will look like. Write it down as follows: b. the sequence of DNA Daughter 1: 3' 5' 5' 3' C. the sequence of DNA Daughter 2: 3' 3' 5' in in
Three students had a disagreement. Student A claimed a strand of DNA was one large molecule, student B said it was in fact two molecules, and student C argued it was an ordered array of many molecules. Who was correct? Or were they all correct? Explain.
Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragment
How Can Fragments of DNA Be Separated From One Another? Agarose gel electrophoresis is a procedure used to separate DNA fragments based on their sizes. DNA is an acid and has many negative electrical charges due to the negatively charged phosphate-deoxyribose backbone. Scientists have used this fact to modify chromatography to separate pieces of DNA. A solution containing a mixture of DNA fragments of variable sizes is placed into a small well formed in an agarose gel (that has a texture similar to gelatin). An electric current causes the negatively-charged DNA molecules to move towards the positive electrode. Imagine the gel as a strainer with tiny pores that allow small particles to move through it very quickly. The larger the size of the particles, however, the slower they are strained through the gel. After a period of exposure to the electrical current, the DNA fragments will sort themselves out by size. Fragments that are the same size will tend to move together through the gel…
"Five prime to three prime" description of a DNA strand refers to: A. the phosphodiester backbone of DNA. B. the phosphorylated 5' carbon at one end, the 3' at the other end. C. the phosphorylated 5' carbon on one sugar and the 3' carbon on the next sugar. D. the location of the hydroxyl groups. KM of a Michaelis–Menten is proportional to: A. The concentration of the ES complex B. The concentration of the substrate C. Both A and B D. Neither A nor B
typical lab bacterial species that grows at 37°C. Explain your reasoning. 13. One strand of DNA reads as follows: 5'-ATG GCG CGA CTG ACT-3' A. How many nucleotides are listed here? B. What are the three structural components of one nucleotide? C. Write the appropriate sequence for the complementary strand above or below the sequence shown. Be sure to include which end of the complementary strand is 5' and which end is 3'.
What determines the sequence of nucleotides in the template strand of DNA? (The answer can be very basic don’t need lots of details)
r this oligonucleotide, ● Classify if RNA or DNA? Justify your choice. determine the sequence of this segment, labeling the 5' and 3' ends. 2. One of the key pieces of information that Watson and Crick used in determining the secondary structure of DNA came from experiments done by E. Chargaff, in which he studied the nucleotide composition of DNA from many different species. Chargaff noted that the molar quantity of A was always approximately equal to the molar quantity of T, and the molar quantity of C was always approximately equal to the molar quantity of G. How were Chargaff's results explained by the structural model of DNA proposed by Watson and Crick? O=P-OCH, O OH O=P- OCH, 0 O HN OH O=P-OCH₂ 0 NH NH₂ NH₂ 00 OH OH