What are the three special proteins needed to form the initial replication bubble?
Q: Which of the following is cytidine? cytosine + guanine ribose + cytosine + phosphate group ...
A: Cytidine is a nucleoside monomer formed when a cytosine gets attached to a ribose sugar via a glycos...
Q: Protein folding
A: proteins are composed of some 20 types of amino acid residues, and they would be more or less alike ...
Q: classify the ff lipids whether it is simple,complex or derived: 1) lecithin 2) tallow 3) retinol 4...
A: Lipids: Lipids are a heterogeneous group of chemical compounds that includes fats, oils, waxes, ste...
Q: Illustrate different types of lipids and relate their chemical structures to their role in the bioch...
A: Lipids are important to our body as they store energy, as well as they are required for cellular str...
Q: Amino Acid: Asn-Met-Ser-Ile-Phe-Arg-Cys-Tyr-Lys What is the one letter code of this amino acid ...
A: Amino acids are compounds containing carbon, hydrogen, oxygen, and nitrogen. They are the building b...
Q: A solution with a pH of 2 has a hydrogen ion concentration that is _______________ the hydrogen ion ...
A: pH is a measure of the negative logarithm of the hydrogen ion concentration. Given Values: pH = 2.0...
Q: Draw the product of the reaction below. (Upload your answer here) H- но ? NaBH4 HO -H H- ČH2OH
A: Given structure :- D-GALACTOSE (monosaccharide) In presence of NaBH4 , REDUCTION reaction oc...
Q: Formulate a developing heifer ration containing 14% CP on a DM basis. The feeds to be used are corn ...
A: Using pearson square method, the feed ration found out.
Q: Carbon is particularly well suited to be the backbone of organic molecules because (a) it can form b...
A: Carbon is a chemical element with an atomic number of 6. Carbon is non-metallic and has four electro...
Q: QUESTION 9 What are the various ways of dispensing heparin in a biomaterial? Compare and contrast.
A: Heparin is a linear polysaccharide synthesized from proteoglycan. Heparin is made up of repeating di...
Q: how many ATP synthesized by oxidation of NADH by O2? Compare it with the ATP synthesized by oxidatio...
A: Electron transport through complexes I, III, and IV is coupled to the transport of protons out of th...
Q: You have isolated a new bacteriophage and determined that the composition of its is nucleic acid is ...
A: The double-stranded helical structure of DNA is maintained primarily due to the hydrogen bonds betwe...
Q: What group is added to modify methionine on the initiator tRNA in bacteria O phenyl O formyl O methy...
A: Initiator tRNAs (tRNAi) transport methionine (or its product, formyl-methionine) to ribosomes, where...
Q: What are the relative amounts of the different splice forms and chemically modified forms (e.g., pho...
A: Golgi do post-translational modifications in protein. Such as attaching carbohydrates wit...
Q: Help with enzyme catalysts #5 please
A: A naturally occurring enzyme lysozyme is present in secretions such as saliva, milk, and te...
Q: What are the disadvantages of using genetic engineering to obtain resistant plants?
A: The new genetic material (DNA and genes) has been transfecting or reprogramming cultured ce...
Q: A solution has a hydrogen ion concentration of 0.01 mol/L. What is its pH? What is its hydroxide ion...
A: Given Values: [H+] = 0.01 Mol/L = 1×10-2 M pH is a measure of negative logarithm of hydrogen ion con...
Q: Which nucleotide is shown in the picture above?
A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Sugar binds with nitrogenous base b...
Q: What is the function of DNA polymerase a in eukaryotes? lagging strand synthesis leading strand synt...
A: Replication of eukaryotic cells employs three DNA polymerases: polymerase α, δ, and ε .
Q: A polypeptide with a pH of 2.0 has a total net charge of 0. Gly-Pro-Glu-Asp-Leu-His-Ile-Gln-Asn-Phe ...
A: This peptide is composed of glycine, proline, glutamic acid, aspartic acid, leucine, histidine, isol...
Q: What is the concepts of the native conformation of proteins? Why and how do proteins refold and unfo...
A: Proteins are polypeptide structures consisting of one or more long-chain amino acid residues. They a...
Q: Define the term isomer and distinguish among the three principal isomer types.
A: Molecules are composed of atoms. Atoms are the smallest particles of an element that can exist. Atom...
Q: rate at an extremely high temperature
A: Enzyme activity is being measure by a property of enyzme that is able to increase reaction rate as c...
Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the pho...
A: Here in question, I believe “a” side in Phosphodiester bond refer to the side bond to 3’-C atom of t...
Q: Based
A: Insulin binds to the receptor activates several cascade of events.
Q: Which of the following make up a nucleotide? phosphate + sugar base + sugar base + sugar + ...
A: Nucleoside= Nucleotide - phosphate group In a nucleoside, the anomeric carbon is linked through a gl...
Q: 1. What are the numbers of carbon atoms derived from the first acctyl-CoA that binds to fatty acid s...
A: Fatty acid synthase complex bind to Acetyl-CoA and other substrate and combine the C-atom backbone i...
Q: You have 10 mg/ml ethidium bromide solution. If you add 5 µl of this to 50 ml of agarose gel solutio...
A: Gel electrophoresis is a laboratory method for separating DNA molecules depending on their size and ...
Q: name the enzyme that is used in this reaction and explain why
A: It can be observed that a phosphate group is added to the product so the enzyme must be a Kinase.
Q: A protein with a positive charge at physiologic pH (7.4) most likely contains amino acids with Basic...
A: Protein is essential for the body. Without proteins, the organs and functions of the body cannot su...
Q: 1. Would you say that indicator tests are qualitative or quantitative? Explain your answer.
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: The following peptide (alanylglutamylglycylalanylleuci ne) has.. O A disulfide bridge. O Five peptid...
A: Different amino acids are connected via the peptide bond to form a peptide. Each amino acid has a N-...
Q: D- galactose and L- galactose is .. ..
A: Galactose, also known as Gal, is a monosaccharide sugar that is nearly as sweet as glucose and about...
Q: Write a short description on ALL of the following: a) The application of turbidostat against chemost...
A: In various assays and biological experiments, microoorganisms are allowed to grow in liquid cultures...
Q: ENDOSYMBIOTIC THEORY application to this subject (BIOMOLECULES)?
A: Endosymbiosis is one of many different types of symbiotic connections (symbioses) that can exist bet...
Q: Why Mayana Leaves (Coleus Blumei Benth) contain anthocyanin?
A: Most of the plants that we see around us are of green color because of the special pigment present i...
Q: Define triad
A: Those organic molecules are mainly comprised of two functional groups; an amino group and a carboxyl...
Q: 6. Delineate the steps in the production by a human of a C20:3 45, 8, 11 fatty acid. Make sure your ...
A: Fatty acid metabolism includes Fatty acid biosynthesis (an anabolic process) and β- oxidation o...
Q: Draw the Micelle generated when the soap is dissolved in water and the heater. For this representati...
A:
Q: Is the H+/sucrose cotransport system involved in passive or active transport? How do you know?
A: Secondary active transport is the transport in which the electrochemical gradient that is generated ...
Q: The folding of a protein a involves unfavorable entropy b involves favorable entropy c ...
A: Amino acids are biomolecules that are comprised of two functional groups, these are an amino group (...
Q: I have four amino acids: serine, histidine, alanine, and tyrosine. How many different primary struct...
A: Proteins are composed of amino acids linked together by peptide linkages. T he primary structure of ...
Q: 1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the follow...
A: I Double stranded DNA the base pairing between the strands occurs as follows: A pairs with T and G ...
Q: nucleic acid. b) . What is/are the major chemical difference(s) between RNA and DNA?
A: It is the question about nucleic acid i. DNA and RNA. Both DNA and RNA are nucleic acid but though ...
Q: How many phosphate groups are part of the nucleotide? (A) 2 only B) 1, 2, or 3 c) 1 only D) 3 only
A: S.No. DNA RNA 1 Deoxyribonucleic Acid. Ribonucleic Acid. 2 Generally double stra...
Q: Why do you think DNA is the genetic material used by eukaryotes instead of RNA?
A: Deoxyribonucleic acid (DNA): Nucleic acids are molecules that store hereditary information for perf...
Q: Ication. A: Determination of pH Using Acid-Base Indicators: Indicator Color HCI NaH,PO, HC,H,O, ZnSO...
A: Indicators are substances that are used to detect the presence of specific substances by giving cert...
Q: Now imagine that only the Cu center was replaced by Zn(II). What would you expect to happen to the c...
A: c) Cytochromes are heme protein which contains two hemes, a cytochrome a and cytochrome a3, and two ...
Q: Wavelength vs. Absorbance UV - VIS Residual Graph 0.05 -0.05 -0.1 -0.15 -0.2 -0.25 220 240 260 280 3...
A: The residual plot shown here is Wavelength Vs Absorbance plot has unique pattern. Here, plot is show...
Q: What is the classification of phopholipids and the biochemical role of each phospholipid group.
A: Phospholipids :- derivatives of phosphatidic acid. They are associated with biological membranes. A ...
Step by step
Solved in 3 steps
- What is bidirectional replication?The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side1) A bacterial chromosome contains 6.4 million nucleotides of DNA. If synthesis at each replication fork occurs at a rate of 1800 nucleotides per second, how many minutes will it take to completely replicate the chromosome with theta replication? 2) What different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met-Trp-Ile? (Include the stop codon)
- What is the purpose and benefit of the polymerase chain reaction?2) Replicating structures in DNA can be observed in the electron microscope. Regions being replicated appear as bubbles. a) How many replication forks are present? b) Assuming bidirectional replication, how many origins of replication are active in this DNA molecule? c) Assuming that all replication forks move at the same speed, which origin of replication was activated first (left, middle or right)? Why?a) Under normal conditions E. coli produces three DNA polymerases. State their functional similarities and differences. b) List the other proteins and enzymes involved in DNA replication in E.coli and give their functions.