The genetic code is said to be degenerate. This means that... A the code is universal used by virtually all species B) each anticodon can interact with many different triplets C) each codon codes for more than one amino acid D) many amino acids are coded for by different codons
Q: What is the amount (mL) of pre-culture (108 cell/mL) necessary to inoculate (to add) in a 2-liter…
A: Culture media is a solid or semisolid substance used to support the growth of microorganisms. It is…
Q: Directions: Using the illustration of glucose (6-carbon compound) below, illustrate how glycolysis…
A: Glycolysis is metabolic process in which glucose broken down to produce energy. It produce…
Q: In corn, male sterility is controlled by maternal cytoplasmic elements. This phenotype renders the…
A: Hi dear, here's your answer what you want. Can you please give me an upvote for this answer.
Q: What fundamental structure organization allows both chloroplasts and mitochondria to establish a…
A: Chloroplast is responsible for photosynthesis. Whereas mitochondria is responsible for respiration.…
Q: Table of Energy Carriers Produced in Glycolysis, the Transition Step, and the Krebs Cycle of FADH,…
A: Glycolysis is an important pathway used to generate energy from glucose. As the name suggests, it is…
Q: Question 8 In the following plasmid, if the region between the 2 sites for HgiEll were deleted, the…
A: Origin of replication is the DNA sequence in the plasmid from where the replication of the plasmid…
Q: Which level of gene regulation is involved for some genes with higher gene copy number? O genome…
A: ANSWER;-Transcriptional Explain;- Gene regulation alludes to the instruments that act to induce or…
Q: Which of the following responses is an effector activated by the hypothalamus when the body…
A: ANSWER) (b) skeletal muscles contract Contraction of skeletal muscles is the response activated by…
Q: Learning Task 16-02 - Disinfectants Microorganism Clostridium Difficile Papilloma Virus Bordetella…
A: All surfaces are hand washed or disinfected with a power washer using a chemical solvent that kills…
Q: Ungent, o) Explain FIVE (5) impacts from the environmental perspective with examples of coastal…
A: With the increasing globalisation and Technology the world has become a global village where…
Q: The toxin produced during this infection stops cilia movement and is a major contribution to the…
A: Pathogenic microrganism are those which have ability to cause diease in other organisms .…
Q: D. What are STICHIOCYTES? What are its uses?
A: Stichiocytes are the fragmented part of the red blood cells . These are irregularly shaped , jagged…
Q: Arrange the steps in the base excision repair process. Write the capital letter corresponding each…
A: Base excision repair Base excision repair is a DNA repairment mechanism in which the incorrect…
Q: Question 2 A method used to insert or transform cells with a plasmid is to: A add the DNA to…
A: There are two ways of gene transfer by which foreign DNA can be introduced into the host cells: 1)…
Q: 5) There are several coronaviruses in the database, why is the SARS-CoV-2 so dangerous?
A: SARS-CoV-2 virus reduce microRNA level in this way that suppor viral replication anf inhibit…
Q: Answer Everything. Kindly skip if you're not interested to answer them. Read Chapter 12 of Egan's…
A: Oxygen is transported around the body by hemoglobin, which is found in red cells. Oxygen does not…
Q: 35. Which test tube contains the bacteria that strictly require a low oxygen concentration? O b. O…
A: Unicellular prokaryotic organisms, containing primitive nucleus, that can survive under all kinds of…
Q: ALS cause degeneration of motor nerves which control voluntary muscle movement. Which of the…
A: ANSWER) (d) Creatine Skeletal muscles have large amounts of Creatine substances because it is…
Q: All steps in the calculations must be reported, incomplete reporting of these leads directly t…
A: Acetyl coenzyme acts as an allosteric activator of enzyme pyruvate carboxylase. This enzyme adds CO2…
Q: What are the organs upper end and lower ends of oesophagus connected to?
A: The oesophagus (sometimes spelled Esophagus) is a 25-centimeter-long cylindrical tube-like structure…
Q: Directions: Complete the Krebs Cycle process below. KREBS CYCLE 2-C CoA-SH NAD+ 4-C 4-C FAD CoA-SH…
A: Krebs cycle is also known as TCA cycle. This cycle is one of the biochemical pathway involved in the…
Q: C. Discuss the pathogenicity of Capillariasis. infection? How can human acquire the
A: Capillariasis is also called as capillaria infection which is caused by parasite of two different…
Q: 4 Rajah 4 menunjukkan keratan rentas daun Diagram 4 shows a cross section of an eudicot leaf.…
A: The process T that is shown in the figure is transpiration. Transpiration is loss of water from the…
Q: Muscarine is a metabotropic acetylcholine receptor agonist. If these receptors open Na+ channels…
A: Introduction :- Acetylcholine receptors are ion channels with extracellular, intramembranous, and…
Q: ing the slide. The student used an eyepiece graticule to calculate the size of some of the onion…
A: The spaces on the ocular micrometer or eyepiece graticule are called ocular units and the divisions…
Q: 27. A bottleneck can result in a(n) likelihood of genetic drift. a. increase; increasing b.…
A: Genetic drift Rapid or sudden change in the proportion of gene in a population is known as genetic…
Q: Microevolution - More Mechanisms - V2 There are 5 mechanisms that affect real populations resulting…
A: Since you have asked multiple questions we will solve the first question for you. If you want any…
Q: Construct a cladogram from 3. Explain how EACH of the following could have played a role in the…
A: Answer-----
Q: Which is NOT part of innate immunity? Group of answer choices antibodies and cytotoxic T-cell…
A: Innate, or nonspecific, immunity is the defense system with which you were born. It protects you…
Q: 34. What endocrine gland modulates sleep/wake patterns of an individual? Group of answer choices…
A: Sleep-wake cycle refers to our 24 hour daily sleep pattern which consists of approximately 16 hours…
Q: Which of the following sequences gives the correct order for urine formation? Group of answer…
A: The transparent yellowish, acidic fluid, with a characteristic pungent odour, that contains the…
Q: Which chemical signaling affects neighboring cells? Group of answer choices neuron autocrine…
A: Cells typically communicate using chemical signals. These chemical signals, which are proteins or…
Q: There is energy requirement for every amino acid added in a growing polypeptide chain. A True B)…
A: Translation is a process of synthesizing of amino acid chain. In the first step of translation,…
Q: individual
A: Yes its a true statement , Hepatitis D virus is a type of the satellite virus that affects the…
Q: 1. Differentiate the types of culture media based on its physical state and uses.
A: MICROBES This is why they are given names such as microbes.They produce 60% of the living matter on…
Q: 8. Which pair of digestive enzymes is secreted by pancreas? Group of answer choices bile salts and…
A: The pancreas is an organ located in the abdomen. It plays an essential role in converting the food…
Q: Which DNA repair mechanism is described? In E. coli, MutH recognizes the correct template through…
A: ANSWER) (a) Base excision repair Base excision repair involves the recognition of damage, assembly…
Q: Which of the following are the three important questions that should be considered when explaining…
A: Relationships between the human social system and (the "rest" of) the ecosystem are known as human…
Q: The body plan of an annelid displays. meaning that the body is divided into a series of repeated…
A: The phylum Annelida is an invertebrate phylum. Annelids are triploblastic coelomates with bilateral…
Q: Which structure contains smooth muscle? Group of answer choices gluteus maximus internal anal…
A: Muscles in our body play a vital role based on their localization. So the study of them provides…
Q: Define two fungal pathogens, and also write its morphological characterization.
A: Fungus is a type of eukaryotic organism that includes microbes like yeasts and moulds, as well as…
Q: What is the pattern of distribution of koi fishes (Cyprinus rubrofuscus)? What are the limiting…
A: The colored varieties of the Amur carp are called as the Koi fish. These are used for the decorative…
Q: 1.Discuss how the term sustainable development emerged? 2. Discuss Kyoto Protocol (1997) vs. Paris…
A: Global warming is the major environmental issue in which the earth's temperature rises at an…
Q: Andoy regularly visits his rice field each morning to see if the plants are growing healthy with…
A: From the symptoms of the disease it can be concluded that the disease is Sheath blight affecting the…
Q: What gland is responsible for secreting water and salt for temperature regulation? Group of answer…
A: Glands secrete certain substances in response to a particular stimulus. They could be of two types…
Q: Directions: Using the illustration of glucose (6-carbon compound) below, illustrate how glycolysis…
A: A series of chemical reactions which are linked to each other occurring within a cell constitutes…
Q: How can you apply the knowledge about disturbance in ecology and biodiversity? Discuss each…
A: Disturbance plays a significant role in shaping the structure of individual populations and the…
Q: Describe and contrast the common steps of DNA replication in vivo and the PCR reaction in vitro? In…
A: DNA replication and Polymerase Chain Reaction are both processes that create copies of DNA. DNA…
Q: 1. Describe how you can differentiate B. malayi and W. bancrofti
A: Adult worms are creamy white, filiform and have cylindrical body with tapering ends. Posterior end…
Step by step
Solved in 2 steps
- Question 1. Suppose that the diagram below represents the genomic organization of an enzyme involved in eye pigment production in mice. Within the gene are four exons. Biochemical analysis has revealed that the active site of the enzyme is located in the C terminus of the protein. The nucleotide length of each exon and intron is shown. The dinucleotide sequence GT represents the 5’ splice site and the dinucleotide sequence AG represents the 3’ splice site. Both the 5’ and the 3’ splice sites must be present for splicing to occur. Assume that the first and second stop codons are located immediately after the first and second 5’ splice sites, respectively; the third and fourth stop codons are located near the 3’ end of exons 3 and 4, respectively; all these stop codons are in the correct reading frame. E) Suppose you isolate a mutant mouse that has white eyes. When you examine the size of the eye pigment enzyme produced by this mouse, you see that it is 400 amino acids long. Sequence…Question 28 The anticodon of a tRNA is 5'UUG. What codon(s) can be theoretically recognized by this tRNA? A) 5'AAC & 5' GAC B) 5'CAA only C) 5'CAA & 5'CAG D 5'AAC onlyQuestion 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 3' 5' GATTCCGTATTACAGCATAGGCTATATT CACGTGGATGGTCAGTA... 3' CTAAGGCATA ATGTCGTATCCGATATAAGTGCACCTA CCGATCAT... 5' Start site
- Question 1: Look at the following normal and mutant DNA sequences. Normal Sequence (5'-3'): ATG AAC GTT ATC GCA Mutated Sequence (5'-3'): ATG AAT GTC ATC GCA a) What type of mutation has occurred (be specific)? b) Fill in the table for the normal and mutated sequences. Starting with the given 5'-3' sequence, input the complementary DNA, transcribed RNA from the 3'-5' DNA and translated polypeptide sequence for both. Hint: use the codon table! Normal sequence Mutant sequence DNA 5'-3' (given) DNA 3'-5' RNA Polypeptide (use 3 letter codes) c) Based on parts A and B above, what is the ultimate effect this mutation has had on the polypeptide? (1 sentence summary)Question 2. From mouse nerve cells you isolate the mouse Tau-gene-containing DNA fragment and hybridize it to the mRNA encoding Tau from the cytoplasm of the same cells. Describe what you see when you look at the molecules under the electron microscope. A. A double-stranded DNA-RNA hybrid with complete overlap of all the sequences. B. A partially double stranded DNA-RNA hybrid molecule containing regions of DNA-RNA overlap representing the mRNA exons, loops where there are introns and tails at the 5' and 3' ends. C. A partially double-stranded molecule containing regions of DNA-RNA overlap representing the mRNA introns, loops where there are introns and tails at the 5' and 3' ends. D. Regions of DNA-RNA overlap representing the mRNA exons and loops where there are introns with no tails at the 5' or 3' ends. E. Two distinct molecules with no overlapping regions. Multiple ChoiceQuestion 2 Match the term and its description. Each term can only be used once. a series of nonoverlapping, three-nucleotide words [Choose J This DNA strand provides a template for ordering the sequence of complementary nucleotides in an RNA transcript | Choose ) the MRNA base triplets [ Choose J Codons must be read in the correct groupings in order for the specified polypeptide to be produced. These correct groupings are [ Choose J called > > > >
- Question 2. Ribosomes are cellular structures that are composed of protein and RNA; this structure is responsible for catalyzing peptide bond formation between amino acids during a process known as translation. a) Many antibiotics that kill bacteria target translation. Why might this be an effective mechanism to kill bacteria? Why don't antibiotics also kill human (eukaryotic) ribosomes? b) The antibiotic Kasugamycin (KSG) destabilizes the P-site of the ribosome. Describe what parts of translation would be altered in the presence of this antibiotic. c) How does the following graph show the efficacy of translational knockdown with KSG? Met-Methionine C % of Met incorporation 100 80 60 40 20 0 + 0 2 4 6 8 KSG concentration (mg/ml) 10Question 1: Define and give an example of the following: Codon, Start Codon, Anticodon, and Stop Codon. a) How is information from the DNA code copied and moved to the cytoplasm? b) What are the base pairing rules followed when one DNA strand is read and an mRNA made? Question 2: What eukaryotic sub-cellular structure is responsible for making proteins? a) Is this sub-cellular structure present in prokaryotes? b) What is the name of the enzyme responsible for making the mRNA? c) Is DNA always inside the nucleus of eukaryotic cells?Question #3: CRISPR has been used to cure an individual from sickle cell. Below is a Sanger electropherogram of a sequence from a patient without sickle cell and one with sickle cell. Sequence from a normal individual mmmm Sequence from the diseased individual G T GIIC A GC A Se SCIENCEphe A G A SCIENCE SCIENCEphoto G a) Where is the change in the sequence and what is the consequence to the protein sequence of this mutation? b) Below is an image of the normal and diseased quaternary hemoglobin protein. What is different about the protein shape and why does that structure have a huge impact on its function (please name the function!)? Adult haemogBRAR G G G G A G Sickle Cell haemoglobin S Structure a s RARY COLIBRARY c) If you were to use CRISPR to modify the genome of a diseased individual, to which nucleotides might you design your guide RNA? Why? d) RNA Seq is used to determine off-target effects of Cas9 cleavage. Why is this an appropriate tool to determine these effects? e) Data on…
- Question 8. How is the green fluorescent protein (GFP) attached to the protein for which it serves as a label allowing that protein's dynamic activities to be tracked? A. The GFP itself is attached directly to the coding region of the gene of the protein being studied. B. A recombinant RNA is produced by attaching the GFP mRNA to the mRNA of the desired protein. C. GFP adheres specifically to the desired protein via weak interactions. D. The coding region of the GFP gene is joined to the coding region of the gene that encodes the protein being studied.Question 1: The diagram below depicts an eukaryotic gene. In which region would the insertion of a single basepair of DNA be most likely to cause a frameshift mutation? TATA. . ..ATG...... .TGA.. -30 intron A B C AGA AGG GCA CGA GCC CGC GCG CGG GAC AAC UGC GAA CAA GGG CAC AUC CUG AAA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG UUU CCU UCU ACU UGG UAU GUU UUA UUG CỦA AUA CUC AGC AGU CCA UCA ACA CCC UCC ACC UUC CCG UCG ACG GGA GGC GUA GUC UAC GUG UAA UAG UGA le Leu Lys Met Phe Pro Ser Thr Trp Tyr Val stop Ala Arg Asp Asn Cys Glu Gin Gly His M F T. W Y. V R E GQUESTION 21 Suppose the following are sequences at the 5' splice junction and the 3' splice junction, with intervening intron sequences shown as dashes and the branchpoint A shown, not surprisingly, as 'A'. What is the sequence formed after splicing? 5'-CUCAAUGGUACA- -----CGAUACGAGCACUGACC-3' O A. 5' CUCAAUGCACUGACC 3' O B. 5' CUCAAUGACC 3' O C. 5' CUCAAUGGGCACUGACC 3' O D. 5' CUCAAUGGUGACC 3' O E. 5' CUCAAUGGUACACGAUACGAGCACUGACC 3'