The enzyme guanylyl transferase is usually associated with which of the following? phosphorylated CTD of RNA polymerase I The 3' ends of exons phosphorylated CTD of RNA polymerase II unphosphorylated CTD of RNA polymerase I unphosphorylated CTD of RNA polymerase II

The enzyme guanylyl transferase is usually associated with which of the following? phosphorylated CTD of RNA polymerase I The 3' ends of exons phosphorylated CTD of RNA polymerase II unphosphorylated CTD of RNA polymerase I unphosphorylated CTD of RNA polymerase II

Name: Please answer fast The enzyme guanylyl transferase is usually associat
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Please answer fast The enzyme guanylyl transferase is usually associated with which of the following?phosphorylated CTD of RNA polymerase IThe 3' ends of exonsphosphorylated CTD of RNA polymerase IIunphosphorylated CTD of RNA polymerase Iunphosphoryl

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 11TYU

See similar textbooks

Similar questions

A peptidyl-tRNA in the P site has a strange modification with an ether versus an ester bond to the tRNA. When it is in the P site undergoing catalysis in the otherwise normal way, this molecule will become: More susceptible to the nucleophilic attack A better nucleophile O Less susceptible to the nucleophilic attack A worse nucleophile
Which of the following sequences represents a recognition site for N-linked glycosylation where X is any amino acid residue? Gln-X-Ser O His-X-Ser O Arg-X-Ser O Asn-X-Ser O Asp-X-Ser
Figure 15.16 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis? Tetracycline would directly affect: tRNA binding to the ribosome ribosome assembly growth of the protein chain Chloramphenicol would directly affect tRNA binding to the ribosome ribosome assembly growth of the protein chain
Which of the following would be a good chemotherapy approach: blocking formationof the ribonucleotide GTP or blocking formation of the deoxyribonucleotide dGTP?Why? Please explain the chemical differences between each of the two nucleotides. Use the specific processes below to support your choice by explaining how either GTP or dGTPare related to these and how loss of the particular molecule would affect each process. *PEP carboxykinase in gluconeogenesis*Succinyl-CoA synthetase in the TCA Cycle*Glucagon signal transduction
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
In bacteria which ribozyme catalyzes synthesis of peptide bonds between amino acids? 16S FRNA 5S FRNA 23 FRNA
Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the following sense strand of DNA: 5'-AUG UCU GAC UAG TTG GAT CCC - 3' Second position First position (5' end) Third position (3' end) Phe Ser Tyr Cys U Phe Ser Тут Cys Leu Ser Stop Stop A. Leu Ser Stop Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gln Arg Leu Pro Gln Arg Ile Thr Asn Ser U Ile Thr Asn Ser Ile Thr Lys Arg A Met Thr Lys Arg Val Ala Asp Gly U Val Ala Asp Gly C Val Ala Glu Gly A Val Ala Glu Gly O a. Lys-His-Ala-Gly-Asn-Leu-Val O b. Val-Val-Ser-Pro-Leu-Asp-Thr
Which of the following cannot be said regarding aminoacyl tRNA synthetase? It is essential for the correct reading of codons. A single tRNA synthetase can attach different amino acids to their corresponding tRNA. It is first activated when it catalyzes a reaction between ATP and an amino acid to form an aminoacyladenylic acid (amino acyl-AMP). It is responsible for the attachment of the correct amino acid to the correct tRNA. There is a different tRNA synthetase for each amino acid that will be attached to a tRNA.
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
Which statement is true for the active site residues of RNase A, lysozyme, or trypsin? Select any/all answers that apply. O A. His12 (RNase A) initially acts as an acid. O B. His119 (RNase A) initially acts as an acid. O C. Glu35 (lysozyme) initially acts as an acid. O D. His57 (trypsin) initially acts as an acid. O E. Ser195 (trypsin) initially acts as an acid.
Which of these statements is true about the elongation step of translation? The growing polypeptide chain is transferred from the P site RNA to the A site RNA OThe MRNA moves through the ribosome OThe new amino acid is transferred from the A site tRNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide
The synthesis of a protein requires that the amino acids that constitute the growing polypeptide chain be covalently linked to the amino acid attached to the tRNA at the aminoacyl site of the ribosome. Which of the following catalyses this reaction? Options: the aminoacyl tRNA synthetase eEF2 eEF1-GTP a large ribosomal RNA the initiator tRNA met