The DNA sequence below is used by the primase to synthesize a primer. What is the sequence of the primer? 5’-ACGTGCT-3’

When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were obtained: Tetranucleotide Hexanucleotide Nonanucleotide Decanucleotide Dodenucleotide Octadecanucleotide Nonadecanucleotide 21-nucleotide 6c. What is the sequence of the bases in the mRNA coding for the peptide above? The

Why would you NOT expect a restriction endonuclease to exist that would recognize the site AAGGAA?

What is the difference between primase and DNA polymerase alpha?

If deoxyribonucleotides that lack the 3’-OH groups are added during the replication process, what do you expect will occur? Describe what happens when a nonsense mutation is introduced into the gene encoding transposase within a transposon. A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice that the colony morphology is strikingly different on plates of minimal media with glucose compared to that seen on trypticase soy agar plates. How can you explain these differences in colony morphology?

DNA polymerase I (Pol I) of E. coli consists of three functional parts (domains): an N-terminal domain with 5´ to 3´ exonuclease activities required for removal of the RNA primer, a central domain responsible for 3´ to 5´ exonuclease proofreading, and a C-terminal domain with polymerase activity. Pol I is thought to simultaneously remove RNA primers and fill in the gaps that result. A group of proteins known as RNaseH also have 5´ to 3´ exonuclease activity and can thus remove RNA primers. However, they lack the other two functions observed for Pol I. Predict the ability of the following mutants to replicate DNA:   (1) a strain with a mutant gene encoding Pol I such that it no longer has polymerase activity (but retains both types of nuclease activities);    (2) a strain without RNaseH proteins;   (3) a strain with a mutant gene encoding Pol I such that it no longer has 5´ to 3´ exonuclease activities (but retains 3´ to 5´ nuclease and polymerase activities);    (4) a strain with…

The function of the 3'-> 5' exonuclease activity is found in which of the following: DNA Polymerase III DNA Polymerase I DNA Polymerase II All of the above

Describe three examples of specific recombinases that have been discussed in this class. Include a brief description for the function of each specific recombinase.

The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC.  2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?

HgaI recognizes a specific 5 bp sequence. How frequently would you expect a specific 5 bp sequence to be found in any genome, considering that there are 4 possibilities for each of the 5 nucleotides in the restriction site sequence?