The amount of DNA inintronic regionof genes can be grwater than the amount of DNA in exons. true

The original wild-type" DNA strand is: 5'-ATGGGACTAGATACC-3'. Which allele is least likely to show a mutant phenotype? First letter A U UUU UUC UUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala 5'-ATGGGATAGATACC-3' ● 5'-ATGGGTCTAGATACC-3' O 5'-ATGCGACTAGATACC-3' O 5'-ATGGGACTAGTTACC-3' CAU CAC CAA CAG UAU Tyr UAC UAA Stop UAG Stop UGG Trp AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu UGU UGC Cys UGA Stop A CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg DOAG JOAG DO AO | DOA Third letter Gly C G

Describe the size (in base pairs) of the bands anticipated forDigested TT DNADigested Tt DNADigested tt DNA Undigested DNA  asap typed

A double-stranded molecule of B DNA contains 340 nucleotidesWhat topic in genetics does this question address?

which of the follocoing wauleng ths ranges is use d of DNAĄ to measue absorbence 10 0 -200 nm 200-40onm yo0-700 nm 700-l000onm

Below is the sequence of a single strand of a short DNAmolecule. On a piece of paper, rewrite this sequenceand then write the sequence of the complementarystrand below it.GTTCGCGGCCGCGAACComparing the top and bottom strands, what do younotice about the relationship between them?

What is the melting temp. of the following double-stranded DNA fragment   TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT

As the minor and major grooves wind around a DNA double helix,do they ever intersect each other, or do they always run parallel toeach other?

I'd examine chromosomal dna what characteristic would cause you to believe sequence contard transposable element

Bloom syndrome in regards to faulty DNA give detailed reponses  provide exmaples