Suppose a liver extract capable of carrying out normal metabolic reactions (including gluconeogenesis) is incubated with pyruvate partially labeled with deuterium at the methyl group (see below: D= deuterium, i.e., H-2) a) Explain why the oxaloacetate formed in step 1 of gluconeogenesis is only partially labeled (i.e., some of the oxaloacetate is labeled and some is not). b) Where would the label be found in glucose?

Suppose a liver extract capable of carrying out normal metabolic reactions (including gluconeogenesis) is incubated with pyruvate partially labeled with deuterium at the methyl group (see below: D= deuterium, i.e., H-2) a) Explain why the oxaloacetate formed in step 1 of gluconeogenesis is only partially labeled (i.e., some of the oxaloacetate is labeled and some is not). b) Where would the label be found in glucose?

Medical Terminology for Health Professions, Spiral bound Version (MindTap Course List)

8th Edition

ISBN:9781305634350

Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

Publisher:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

Chapter2: The Human Body In Health And Disease

Section: Chapter Questions

Problem 44LE

See similar textbooks

Related questions

Q: What technique seperates proteins based on their ionic charge?

A: Proteins are high molecular weight polymers of amino acid residues, linked via a peptide bond. Amino…

Q: Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram. C)…

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: INFLUENCE OF FREE ACID tt #1 tt #2 tt #3 tt #4 CONDITION 4 mL 0.2% HCI + 1 mL starch paste + 1 drop…

A: Effect of saliva on starch: Saliva contains the digesting enzyme amylase, which breaks down starch.…

Q: (c) ( To identify the critical enzyme resi- due:substrate interaction and determinant of sub- strate…

A: Phosphotyrosine protein phosphatases (PTPases): These are a group of enzymes that catalyze the…

Q: 1. Calculate the initial velocity (Vo) of a Michaelis-Menten reaction as a fraction of Vmax when [S]…

A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…

Q: determine if stirring (Pé > 1) is more efficient than diffusion (Pé < solutions. “Stirring" here can…

A: U

Q: 7. what are the types of processing a eukaryotic mRNA is subject to, and how do they occur?

A: mRNA is called messenger RNA. mRNA act as a transcript for the synthesis of peptide or proteins.…

Q: Analyze each item carefully and write your complete solution. Cysteine is an important amino acid…

A: Titration curve: Titration curves are created when successive additions of acid or alkali cause the…

Q: Questions Not yet answered Flag question Question 5 Not yet Flag question Complete the following…

A: Note: We are authorized to answer one question at a time. Since you have not mentioned which…

Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…

A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…

Q: Consider the oxidation of a molecule of MANNOSE. (Put the numerical values in the answer boxes.) •…

A: Mannose is a carbohydrate that is composed of carbon, hydrogen, and oxygen in a ratio of 1:2:1.…

Q: Make use of the table below in answering the questions asked: Amino acid pK₁ PK₂ pK3 2.32 9.76 2.32…

A: Isoelectric point is the ph at which the peptide carries a net charge of 0. The proteins are least…

Q: Identify the enzyme/protein involved in replication: multiple choice Addition of short RNA primers…

A: The DNA replication is the process of producing two identical copies of DNA from one original double…

Q: Noncompetitive Inhibitors You can think of noncompetitive inhibition as a combination of both…

A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. They contain an…

Q: b) Why might the compound shown below act as a transition state analog of phosphoglucose isomerase?…

A: Nitrogen containing transition state analogues are used to inhibit the isomerization reaction of…

Q: 50. Express each of the following as a per- centage strength: (a) 1:1500 (b) 1:10,000 (c) 1:250 50.…

A: The Percent solutions can be in the form of weight/volume percentage, volume/volume percentage.…

Q: ENERGY vum Intermediate folding states Folded protein ww CONFIGURATION Figure 1: The Thermodynamics…

A: The proteins are constituted of twenty naturally occurring amino acids that are connected via…

Q: Amino Acid Biosynthesis Q7.2: Describe the biochemistry behind RoundUp Ready crops, i.e., what is a…

A: The first Roundup Ready crops were genetically modified soybeans developed in 1996, that were…

Q: The following is a block diagram where the building blocks are labeled with letters and the linkages…

A: Introduction Lipids are the organic compounds are nonpolar molecules which are soluble only in…

Q: *Is B-D-glucosamine a reducing sugar? HO CH₂OH OH О ОН NH₂ B-D-glucosamine

A: Sugars are of two types-reducing and non-reducing. Reducing sugars have an anomeric carbon has an…

Q: Increased ROS levels are a hallmark for Alzheimer's Disease. This is accurately described by all but…

A: Within a cell, reactive oxygen species are produced as a byproduct of oxygen metabolism and the cell…

Q: Given the following enzyme-catalyzed reaction, identify the class and subclass of the enzyme…

A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…

Q: Give a CHEMICAL test that can differentiate the pair of sugars and give the results for both. No…

A: Introduction: Carbohydrate is an important source of energy that is important for all living…

Q: Can you write possible mineralization and biotransformation reactions for glucose (C6H12O6) ?

A: Biotransformation is the biochemical process (metabolism) taking place in some life form that alters…

Q: The proton-motive force is a measure of the potential energy generated across the mitochondrial…

A: The electron transport chain (ETC) is a chain of electron carriers present in the inner…

Q: Clathrin coat features and activities it participated include Its protein chains, triskelion,…

A: Transport mechanism of macromolecules across the plasma membrane is classified as endocytosis and…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-GCATAAT-3'

A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…

Q: From which biosynthetic pathway is eugenol derived? O A. mevalonic acid OB. shikimic acid O C. mixed…

A: Eugenol is an allylbenzene derivative that is extracted from the essential oils from cloves. It is a…

Q: Which of these structures would you expect to find as part of the transmembrane portion of an…

A: All biological membranes share one common feature: they are impermeable to polar molecules and…

Q: What effect does a negative effector have on the graph of reac- tion rate (V) vs. [substrate] for an…

A: INTRODUCTION : Allosteric enzymes : Allosteric enzymes are those enzymes which have an additional…

Q: 1) Which of the following statement(s) regarding the ends of polysaccharides are true? All…

A: The biological macromolecules can be classified as proteins, nucleic acids, lipids and…

Q: Search the protein data bank (https://www.rcsb.org/)and find an image of one protein that is found…

A: The SARS-CoV-2 virus is the infectious disease known as coronavirus disease (COVID-19). A group of…

Q: Amino acid analysis of a HEPTAPEPTIDE reveals the following information below: (NOTE: when the…

A: The proteins are composed of sequence of amino acids connected via peptide bonds. The sequence of…

Q: What will be the result for each qualitative test if the intact casein contains the following…

A: Protein qualitative tests are test used to estimate the proteins qualitative way, i.e. it identifies…

Q: *Write structures for the straight-chain (Fischer projection) formula and the indicated anomer of…

A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…

Q: What is an example of RNA editing? Changing a valine codon to a stop codon Methylation of cytosine…

A: Nucleic acids like DNA and RNA can be edited in various ways. Editing is done for various reasons…

Q: 1. Oxidative phosphorylation and synthesis of ATP in mitochondria: • ways of ATP formation in cells…

A: Since you have asked multiple questions with multiple sub-parts, we will solve the first three…

Q: Bacteria and other prokaryotic cells have the capacity to get more ATP/glucose oxidized than…

A: “Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Look at this molecule and determine the number of molecules created from B-Oxidation: FADH2, NADH +…

A: Beta-oxidation is the process of degradation of fatty acids, in order to synthesize energy during…

Q: B-lactamase is an enzyme found in many antibiotic-resistant bacteria that hydrolyzes and inactivates…

A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They contain an…

Q: Briefly describe the role and location of each cofactor/coenzyme involved in the pyruvate…

A: Pyruvate is the end product of glycolysis. Under aerobic conditions, pyruvate is oxidised into…

Q: What are the pH buffering regions (pH range) of Glutamyl-histidyl-lysyl-arginine? Click all that…

A: The proteins are composed of 20 naturally occurring amino acids. The net charge on a protein or…

Q: Page 3 2) 7. J a) Glucosidase I catalyzes hydrolysis of specific glucosidase I is a synthetic…

A: Parameters such as Km and vmax are used for comparing enzyme activities. If we know the initial rate…

Q: 5. Molecular structure and principle of action of ATP synthase.

A: Hi! Thank you for the question. We are authorized to answer one question at a time, since you have…

Q: The TPOX locus is one of the genetic loci used for forensic analysis of DNA. The TPOX locus has the…

A: Forensics DNA profiling can be used to solve old or unsolved crimes and to identify the person…

Q: 1. Discuss how the pH and temperature affect the solubility of protein. 2. Explain "salting-in" in…

A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…

Q: The highest level of structural complexity completely retained by the molten globule state of a…

A: The term "molten globule state of a protein "refers to the diverse types of partially-folded protein…

Q: A binding curve for the binding of the amino acid tryptophan to the protein called TxtE is shown…

A: The binding of ligand 'L' to a protein 'P' to form Protein-Ligand complex 'PL' is represented…

Q: Match the following experimental methods with their specialty procedures and objectives.…

A: There are experimental methods that are used in biological processes. Autoradiography, the use of…

Q: 5. 5.1. The outer layer of the placenta expresses an enzyme that facilitates production of 2,3-…

A: Since you have asked multiple questions we will solve the first question for you. If you want any…

Question

a) Explain why the oxaloacetate formed in step 1 of gluconeogenesis is only partially labeled (i.e., some of the oxaloacetate is labeled and some is not).

b) Where would the label be found in glucose?

Chemical pathways by which living things function, especially those that provide cellular energy, such as the transformation of energy from food into the energy of ATP. Metabolism also focuses on chemical pathways involving the synthesis of new biomolecules and the elimination of waste.

Expert Solution