Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the relationship between the four species: M, L, S, and R. B A M L R www M L S R Which of the phylogenetic trees is the most parsimonious? a. Tree B b. Tree D c. Tree C R SML D RM S

Q: Compare and contrast the operation of Optical microscopy and TEM in terms of Contrast (explain all…

A: Microscope is an optical instrument that is used to see microorganisms or very tiny objects which we…

Q: How can lifestyle changes affect chronic diseases management? In what way does early diagnosis help…

A: The term lifestyle can be referred to as a specific way of living that is utilized by the human…

Q: Explain why this carbon cycle diagram does not have a b arrow that shows carbon atoms going from CO…

A: The carbon cycle is a series of activities crucial to preparing the Earth for life. As carbon…

Q: The mouth is part of our digestive system. It would make sense then, that we would have more of the…

A: Cells are dynamic in the sense that they employ energy to accomplish a range of cell tasks such as…

Q: Which of the following are applications of DNA sequencing? Gaining insights into evolutionary…

A: It is the process of determining the sequence of the nucleic acids, the order of nucleotides in the…

Q: You are in a hurry to test a bacterial culture for spore production. You grow the culture or 12…

A: Endospore staining is a procedure used to observe bacterial endospores and differentiate them from…

Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…

A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…

Q: Based on cell theory, how do new cells arise? O They come from the division of other cells The arise…

A: Introduction :- The scientific idea that cells make up living things, that they are the fundamental…

Q: Blood glucose levels remain stable between meals despite the fact that the body's cells continually…

A: Glucose is an instant source of energy. It is used in the process of glycolysis and the citric acid…

Q: Answer it. In Seminal Fluid Analysis, what are aspects of semen that are assessed microscopically?

A: Sperm  The male gamete that is motile and fertilize female gamete.

Q: a. A triploid cell in females

A: Tiploid cell in females :  Triploid is a rare chromosomal abnormality. Triploid is the presence of…

Q: In corn, pigmented aleurone (R) is dominant to colorless aleurone (r), and green plant color (G) is…

A: Given  Green (G) is dominant over yellow (g)  Pigment (R) is dominant colourless (r)  Plant one…

Q: sIMILARITIES AND  DIFFERENCES ecologist vs. environmentalist

A: Differences between ecologist and environmentalist: I) Ecologists are those who study ecology i.e.…

Q: Unlike natural selection, is not related to an individual’s ability to survive and may result in…

A: Natural selection is the variation in individual survival and procreation brought on by phenotypic…

Q: A diploid species has 3 pairs of chromosomes in its somatic cells. In males, the first pair is large…

A: According to the position of centromere present chromosomes can be of different shapes such as…

Q: Based on the a graph, why did the number of wolves increase?

A: Population The similar type of species living together in an ecosystem and can breed is known as…

Q: Proteins trafficked to the golgi arrive ____. In the chloroplast, proteins are trafficked in a _____…

A: Protein trafficking is the transport of proteins to the correct subcellular compartment.  Proteins…

Q: Which of the following is a primary function of the active site of an enzyme?   a. It binds…

A: Enzymes are proteins that help speed up metabolism, or the chemical reactions in our bodies. They…

Q: A. Predict the pressure of nitrogen gas at T =-98 K and v=0.00375 m³/kg on the basis of (a) the van…

A: The symbol p or P is typically used to indicate pressure. It will calculate the force per unit area…

Q: 3 Allele distributions in Generation 1: 36 homozygous dominant individuals 13 heterozygous…

A: Given  p+q = 1  p2 + 2pq + q2 = 1 q = 0.4

Q: This is a molarity problem that I cannot figure out. If you could please help me understand the…

A: To create a solution with a lower concentration, a specific volume of the stock solution is mixed…

Q: explain why the cell membrane must be partially permeable

A: Introduction In biology, a cell is a fundamental membrane-bound entity that houses the building…

Q: 9. Which one of the following histones is a component of the core particle? A. H1 B. H2A C. H2B D.…

A: In 1868, Swiss physician Friedrich Miescher extracted nucleic acids from the nucleus of white blood…

Q: Compare and contrast the operation of optical microscopy and TEM in terms of Magnification

A: Microscopes are instruments that allow the observation of small structures that can't be seen with…

Q: 6. Give an example of negative feedback in nature. 7. Give an example of positive feedback in…

A: Introduction  Positive feedback, also known as exacerbating feedback or self-reinforcing feedback,…

Q: 64 65 calx A pure culture contains only A. one species of microorganism. B. bacteria. C. a variety…

A: Culture:- it is a method of multiplying the microbes as well as eukaryotic cells in a appropriate…

Q: What account for the reduction of levels of soluble carbohydrate and nitrogen of vegetation and…

A: As cattle production rises in America, Africa, and Asia1, grassland lands are becoming more crucial…

Q: Give an example in your daily activities that illustrates each level of organization of ecological…

A: The "niche" of an organism is characterized by the set of conditions, resources, and interactions it…

Q: 4. Know about the recent case of poliovirus in New York State

A: Polio is an infection caused by the poliovirus. About 1 in 4 infected people have flu-like symptoms…

Q: Differentiate between the roles of the pulmonary trunk and the aorta.

A: Introduction The muscular heart of a human being has four chambers and is in charge of pumping blood…

Q: Similarities which have arisen independently in two or more organisms that are not closely related…

A: Evolution is the process of changes which an organism develops with change in the various…

Q: Describe the function of a target cell and explain why it is present in organs. (max 5 points)

A: Cells are the structures of life that together make a tissue. Two or more types of tissues make an…

Q: Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.

A: Evolution is the gradual shift in the inherited traits of natural populations over many generations.…

Q: Summarize the location of the heart in the human body

A: Introduction The physical component of the human organism, the human body is made up of…

Q: Bacteria can evolve.

A: Bacteria are the unicellular prokaryotic organisms. They have a short life span and they divide…

Q: ems Be sure to show your work. Zookeeper hypothesizes that changing the intensity of the light in…

A: A hypothesis is simply a suggestion. A hypothesis to be tested. It is still an open question, and we…

Q: In the late 1900s, two populations of bubble guppies became isolated from each other when a tsunami…

A: Introduction :- Temporal isolation happens when two populations reproduce in distinct seasons or at…

Q: Why does a fiber ( double stranded molecule or duplex) of DNA shorten upon drying?

A: DNA The double helical structure present inside the nucleus.

Q: what does Priming Perspectives and Amplifying Advancements in genescape means

A: The question is posted in biology, I am assuming the question is about relational database…

Q: Proteins trafficked to the nucleus arrive ____. In the mitochondria, proteins are trafficked in a…

A: Introduction  The biological process by which proteins are delivered to their proper locations…

Q: == What was the order of the pigments on the chromatography paper from the bottom up? Postlab 6.13…

A: The chromatographic technique is based on the interaction of solute and solvent molecules. By the…

Q: Which of the following two organisms are most likely to have the highest degree of homology in their…

A: The relationship between DNA or structures descended from a single most recent ancestor is known as…

Q: Antibiotics are medicines that are used to fight bacterial infections. These medicines kill…

A: The prokaryotic cells are considered to be ancestors of the eukaryotic. The prokaryotic cell nucleus…

Q: What is the role of dictyosomes in cell metabolism? What is their forming face? Their maturing face?…

A: Introduction :- In animal cells, the Golgi apparatus appears as a single compact or loose complex…

Q: In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash…

A: DNA is a genetic material in most of the organism. It is two stranded ladder like structure which…

Q: Introduction: The introduction explains the purpose and objectives of the experiment. A good way to…

A: The collection of methods in biology known as "experimental biology" focus on using experiments to…

Q: Describe the role/function of the coronary circulation.

A: Introduction Large and muscular in nature, the heart constantly pumps oxygen-rich blood to the brain…

Q: 6. (top or bottom) Species A, B, C, D, and, E are all extant species (living today, not to be…

A: Note: According to the guidelines, we are answering the first question here. Please repost the other…

Q: 7 8 Which increases the contrast between activated receptive fields and their inactive neighbors?…

A: The nervous system, which controls our thoughts, emotions, and physical processes, is the most…

Q: Compare and contrast the operation of Optical microscopy and TEM in terms of Depth of field

A: Microbes are tiny organism which cannot be seen as such through naked eyes. So , they need special…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.