Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
thumb_up100%
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Species A was recently discovered and its DNA sequence was compared to the DNA of the four previously known species from the same genus. The comparison revealed this particular species is the most recent one, the one that diverged last. Show the mismatched nucleotides between these DNA sequences (mark them and count them) and then draw a phylogenetic tree that shows their relationship. You can draw the tree by hand.Species A 5’ A A G G C C A A A C T T T G G G T A T A G C A T A 3’Species B 5’ A A G G C C A A A C C G T G G G T A T A G C G A A 3’ ____________Species C 5’ A A G G C C A A A C T T T G G G T A T A G C G A A 3’ ____________Species D 5’ A A C T C C A A A C C G T G G G T A T A G C G A A 3’ ____________Species E5’ A A G G C C A A A C T T T G G G T A T A G C G T A 3’ __________arrow_forwardBased on your analysis of the following graph and accompanying cladogram (species have been assigned letters A, B, C, D, E, and F), Which of the following statements is TRUE? A В с D F -20 -15 -10 10 15 Average winter temperature (°C) Phylogeny of species Fur thickness in all 6 of these closely related species is most likely a result of Phylogenetic Affinity, and does NOT suggest an adaptation to differences in Average Winter temperature Fur thickness in the subgroup of species "A", "B" and "C" are most likely a result of Phylogenetic Affinity, and does NOT suggest an adaptation to differences in Average Winter temperature Fur thickness in the subgroup of species "D", "E" and "F" are most likely a result of Phylogenetic Affinity, and does NOT suggest an adaptation to differences in Average Winter temperature Fur thickness in the subgroup of species "A", "B" and "C" are most likely a result of Physiological Convergence. Similarity in fur thickness between species "A" and "D", and…arrow_forwardThe numbers on this phylogeny represent what component of a phylogenetic tree? А в с D a. Nodes b. Branches с. Тіps d. None of the abovearrow_forward
- Circle and label the latest common ancestor between taxon A and E in your tree above.arrow_forwardUsing the information from the DNA-DNA hybridization data table below, build a phylogenetic tree that shows the relationship between species E,R,P,G, and U. Create a scale on the side before you draw itarrow_forwardIs it too much to ask to construct a phylo tree?arrow_forward
- Tree 1 Tree 2 Tree 3 outgroup В C outgroup В outgroup A В We have gathered some morphological data on three species of mythical mammals and the outgroup; these data are presented in the table below. Species Number of toes Eye color Tail Number of molars Outgroup 4 Brown Present 12 A Blue Absent 10 B Blue Present 12 C 5 Blue Absent 10 Now our task is to discover which of the three trees above is the most parsimonious, representing the most likely pathway of evolution. We determine the best tree by fitting the data in the table to each tree and calculating the number of evolutionary changes that are required. To facilitate our calculations, we will use the table below. The numbers in the table indicate the number of evolutionary changes that are required for each character in each tree.arrow_forwardDraw a possible unrooted tree that is the most parsimonious and use the table to do so. Explain why the tree is designed the way you designed it. Be sure to use appropriate language in your explanation such as most recent common ancestor, sister taxon, ingroup/outgroup, reversal, etc.arrow_forwardNeed help what is the difference between a gene tree and a species tree? Explain in your own words how it is possible for gorillas and humans to share a genetic trait (such as a retroviral insertion) that chimpanzees do not share, if chimpanzees and humans are really each other's closest relatives. Given the lack of agreement between gene trees and species trees, how is it possible to reconstruct the true species tree?arrow_forward
- Please help to creating parsimonious treesFor the following DNA sequences determine the most parsimonious phylogeny. Tree ASpecies 1 AATTGCGGGATATATCGCGGGGAAATTTACGACTSpecies 2 AATGTCGGGATATATCGCGGGGAAATTTACGACTSpecies 3 AATTGCGGGATATATCGCGGGGAAATTTACGACT Tree BSpecies 1 AATTGCGGGATATATCGCGGGGAAATTTACGACTSpecies 2 AACTGCGGCATATATCGCGGGGAAATTAACGACTSpecies 3 AAGTGCGCCATATATCGCCCGGATAATTTCGAGA Tree CSpecies 1 CCGTATGACCGGGTATAAATCGCGCCCGGGATCTGCSpecies 2 CCGTATGAGGGGGTATATATCGGGCGCGGGATCTGCSpecies 3 CCGTATGACCGGGTATAAATCGCGCCCGGGATCTGCSpecies 4 CCGTATGAGGGGGTATATATCGGGCGCGGGATCTGC Tree DSpecies 1 GGGATATAGCGCACGATATCGTAGCCTAACGTTTTACGSpecies 2 GGGATATAGCGCACGATATCGTAAGCTAACGTTTTACGSpecies 3 AAAATATAGGCGTGGATATCGTAGCCTAACGTTGCATTSpecies 4 GGGATATACCGCACGTTATCGATCCCTAACGTTTTACGarrow_forwardWhen several possible phylogenetic trees can be produced from a data set, the most parsimonious tree: O is the one that shows the smallest number of synapomorphies. O is the one that shows the largest number of nodes. O is the one that shows the largest number of analogous characteristics. O is the one that shows the smallest number of evolutionary changes. O is the one that shows the smallest number of branches.arrow_forwardas Tutorials Which of the following is NOT TRUE for modern taxonomy? O Modern taxonomy combines the evolutionary history of taxa with knowledge of plate tectonics and paleo-ecological data e 365 st-All HQ O Modern taxonomy is based on phylogeny which incorporates data ranging from fossils to molecules to genes to derive evolutionary relationships ry Resources O Modern taxonomy is focused on patterns of descent in contrast to Linnaean classification which was solely based on morphological traits ter Dashboard es-WLAC O Modern taxonomy is based primarily on morphological data which are highly correlated with genetic relatednessarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education