Answered: skeletal muscle is packed with…

skeletal muscle is packed with myofibrils consisting of a repeating chain of contractile units we call “sarcomere”. What happens when these contractile units slide past each other without

Human Physiology: From Cells to Systems (MindTap Course List)

9th Edition

ISBN:9781285866932

Author:Lauralee Sherwood

Publisher:Lauralee Sherwood

Chapter8: Muscle Physiology

Section: Chapter Questions

Problem 10UC

See similar textbooks

Related questions

Q: Many primary transcripts of noncoding RNAS must bein order to be functional. * none of the above…

A: Non coding RNA It is a functional RNA molecule that skips the last step of the central dogma : DNA…

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 lb. 3/195 of the F2…

A: Parent aabbccdd = 5lb AABBCCDD= 29 lb

Q: Please provide evidence supporting or refuting the following statement: Humans consume microbes…

Q: Describe the trend/pattern in the frequency of M as the population undergoes the following:

A: Key points: Microevolution is a change in the frequency of gene variants, alleles, in a…

Q: 5. How are vestigial structures an example of evidence of evolution?

A: Here we describe the vestigial structures as an evidence of evolution.

Q: What evidence led Emil von Behring to discover antibodies and the complement system in 1905?

A: Antibodies, also known as immunoglobulins, are protein molecules produced by the body's immune…

Q: Compare and contrast anthropocentrism, biocentrism, and ecocentrism. Explain how individuals with…

A: Anthropocentrism is defined as the people who have a human-centered view of a relationship with the…

Q: Which of the following structures is found ONLY in the medulla of the kidney Group of answer choices…

A: NEPHRON Each kidney has nearly one million complex tubular structures called nephrons which are…

Q: 11. Choose from the following types of inheritance and write in the 1" column which one is described…

A: Please follow step 2 for a detailed explanation of the inheritance mode of the given situations.

Q: How can be Palawan bearcat commonly known as Palawan binturong or asian bearcats speciated?

A: The binturong (Arctictis binturong) is a medium-sized mammal, also known as a bearcat, of the…

Q: Agglutination is used only in vivo. to detect bacterial diseases. often as a substitute for…

A: Agglutination refers to the clumping of cells due to result of aggregation between antigen and…

Q: How does the process of DNA replication generate mismatch mutations? What mechanisms are available…

A: DNA replication is the process in which dsDNA is copied to produce two identical DNA molecules.

Q: My Diagnosis for Patient C Sex: Chromosomal Disorder: Justification:

A: Karyotype can be defined as a numbers ;size and shape of metaphase chromosomes.It involves the…

Q: How do studies of brain development in knockout mice support the statement that apoptosis is a…

A: Apotopsis is a process of programmed cell death. It is a process in which the cell division is…

Q: Choose one component of the innate immune system and explain how it is beneficial. This can be part…

A: Immunity that is innate or nonspecific is a protective mechanism that an individual is born with. It…

Q: 1. What is the area (in cm^2) of a small square in hemacytometer?

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: 11. Choose from the following types of inheritance and write in the 1st column which one is…

A: Mendelian inheritance states that the genes assort independently but this doesnot apply to every…

Q: The fossil record (a) usually occurs in sedimentary rock (b) sometimes appears fragmentary (c) is…

A: All life on Earth descended from the universal last common ancestor, who lived between 3 and 4…

Q: why are apples green red and yellow

A: Introduction :- Apple (Malus domestica), one of the most widely grown tree fruits, is the fruit of…

Q: Outline the differences among the three most sophisticated lungsfound in modern animals: the…

A: The insect tracheal system is not dependent on the circulatory system in order to get the oxygen…

Q: List two ways you think would minimise or avoid lag phase of microbial growth

A: During lag stage, the bacteria can adjust to development conditions. It is the period where the…

Q: in Asignacion x What is the xE Untitled do x 234610#question-179879-49 Q O * * a O Dasaoo eO…

A: Antibiotics treat bacterial infections. Fungi cause infections like athlete's foot, yeast…

Q: A scientist has invented a pill that can replace sleep. It is organic, cheap and the only side…

A: Answer

Q: The localization of Ase1 and the phenotype of its deletion imply that this protein binds to…

A: During the cell division, the Spindle which is formed helps in driving the separation of the sister…

Q: DNA gyrase manages DNA tangles and supercoils by breaking DNA strands to allowing DNA to rotate into…

A: Introduction:- During cell division, DNA replication is the process by which DNA duplicates itself.…

Q: Can you describe a scenario in which public health and safety might be threatened by food crops…

Q: O Variolation had high infectious (10%) and death rates (up to 3%). Vaccination was much safer and…

A: INTRODUCTION Variolation was an old method used for immunize infected persons against some deadly…

Q: Explaina about pseudopregnant mouse ?

A: Pseudopregnancy consists of two words "pseudo" which means false and "pregnancy" which means…

Q: Type of Dermal Scale Cosmoid Placoid Shark Tooth Ganoid Cycloid Ctenoid Mammalian Tooth To compare…

A: Introduction cosmoid scales have hard enamel, inner layer of cosmine , and vascular bone layer.…

Q: A woman who has A blood type (her mother had blood type A and her father had blood type B) has a…

A: According to our guidelines, we are required to answer only the first three questions in case of…

Q: Are there any parts of the human body that get oxygen directly from the air and not from the blood?

A: *oxygen is an important gases for human body each cell in human body requires amount to oxygen for…

Q: The experiment uses a redox titration method to measure Vitamin C content in a tablet. Why you…

A: * Vitamin C ascorbic acid is an antioxidant essential for humans this deficiency can lead to a…

Q: Insects are ectothermic and the respiratory rate is usually proportional to the temperature of the…

A: Insects are able to cope with the climatic conditions in different parts of the world due to their…

Q: Metabolism Basics Energy Relationship Type of Reaction Builds Larger Example Amino acids join to…

A: As per our company guidelines we are supposed to answer only first question. kindly repost another…

Q: What are the concepts behind osmosis and enzymatic browning in potatoes?

A: Osmosis is the movement of water or other solvents across a semi permeable membrane from a region of…

Q: number 32

A: Introduction:- A basic unit of heredity and a sequence of nucleotides in DNA that encodes the…

Q: What is the relationship of osmosis to enzymatic browning?

A: Enzymatic browning is a process of food turning brown in color.

Q: a. What role do miscellaneous structures (where applicable) play in the organism's role for…

A: INTRODUCTION External structures are the outer covering all all the livings organisms which provides…

Q: Given the challenges of human population, climate change, pollution and poverty. How would you…

A: The primary difficulties to economical advancement which are worldwide in character incorporate…

Q: if you know the amino acid sequence of a protein can you predict with 100% certainty the DNA…

A: Codon is the genetic code that is formed by permutations and combinations of three nucleotide…

Q: What is body mechanics? Discuss at least 3 principles of body mechnics

A: DEFINITION:- Body mechanics is defined as a way to hold the body for peak efficiency during a…

Q: numerator and denominator mean in the visual acuity chart

A: Visual Acuity Test It is a series of diagnostic techniques used in the examination of eyes, the…

Q: In 1984, Carolyn Greider was using out the enzyme called telomerase that had the ability to add…

A: Chromosomes are the structures formed by the organised arrangement of the DNA molecules located…

Q: Which of the following diseases is/are associated with "Biofilms'

A: Biofilm can be defined as a polymer encased community of microbes(bacteria) that accumulates at a…

Q: What is environmental science? Name several disciplinesthat environmental science draws upon.

A: The term 'environmental science' is a term which is referred to a grouping of scientific…

Q: METABOLIC METABOLITES DISORDERS Alkaptonuria SYMPTOMS DIAGNOSIS Phenylketonuria Gout Ketosis Fatty…

A: Liver is the largest digestive gland of the body it contains several enzymes to control and regulate…

Q: Give two examples of pheromones except sex pheromones and give an example of insect aside from bees…

A: * Pheromones are chemicals secreted by insects exocrine glands and which takes an behavioral or…

Q: Complete the formula for the Krebs Cycle: glucose (sugar) + carbon dioxide anergy C8 ATP)

A: In case of aerobic respiration, single molecule of glucose results in the production of 38 molecules…

Q: Select all examples of DNA transformation Check All That Apply Transfer of DNA through a pilus into…

A: The process through which an organism receives external DNA is known as transformation. There are…

Concept explainers

Muscle Action

A change in the body or a bodily organ as a result of its functioning is referred to as an action. Muscle action can be defined as the specific movement of a bodily part generated by the contraction of a muscle. The muscle proteins actin and myosin are the important contractile proteins involved in muscle action. Muscle contraction, in addition to movement, serves several other important functions in the body, including posture, heat generation, and joint stability. Muscle contraction maintains posture, which includes standing and sitting.

Question

A skeletal muscle is packed with myofibrils consisting of a repeating chain of contractile units we call “sarcomere”. What happens when these contractile units slide past each other without shortening?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In the diagram below, label the fine structure of a muscle, down to one of its myofibrils. Identify the basic unit of contraction in a myofibril.
Figure 38.37 Which of the following statements about muscle contraction is true? The power stroke occurs when ATP is hydrolyzed to ADP and phosphate. The power stroke occurs when ADP and phosphate dissociate from the myosin head. The power stroke occurs when ADP and phosphate dissociate from the actin active site. The power stroke occurs when Ca2+ binds the calcium head.
How does a muscle fiber incur an oxygen debt?
The _____ is the basic unit of muscle contraction. a. myofibril b. sarcomere c. muscle fiber d. myosin filament
How do actin and myosin interact in a sarcomere to bring about muscle contraction? What roles do ATP and calcium play?
In the sliding filament theory of contraction, what prevents the filaments from sliding back to their original positions each time a myosin head releases to bind to next actin binding site?
One of the primary characteristics of all muscle tissue is contractility, the ability to shorten (contract) and lengthen (relax). You've identified the various components of a myofibril above. Now, use the table below to indicate what occurs to each band, line, or zone when the muscle contracts vs. relaxes. What occurs to this region / structure during contraction/relaxation? Region / Structure A-Band H-Band I-Band M-Line Z-Line Zone of Overlap Sarcomere No change Shortens Lengthens Muscle Contraction Muscle Relaxation
What prevents the filaments from sliding back to their original position each time a myosin cross bridge detaches from actin?
What is the most outer covering (made up of areolar connective tissue sheath) of a muscle fiber called? endomysium perimysium epimysium sarcolemma What do synaptic vesicles of a neuromuscular junction contain? sodium serotonin calcium acetylcholine
Watch this video (http://openstaxcollege.org/l/micromacro) to learn more about macro- and microstructures of skeletal muscles. (a) What are the names of the “junction points” between sarcomeres? (b) What are the names of the “subunits” within the myofibrils that run the length of skeletal muscle fibers? (c) What is the “double strand of pearls” described in the video? (d) What gives a skeletal muscle fiber its striated appearance?
Which of the following is the smallest: muscle fiber, thick filament, or myofibril? Which is largest?
If a muscle cell’s sarcoplasmic reticulum had little to no Ca2+, could the muscle cell still produce an electrical impulse, and would the muscle cell still contract? Explain.