Answered: What is body mechanics? Discuss at…

Science

Biology

What is body mechanics? Discuss at least 3 principles of body mechnics

Intro To Health Care

4th Edition

ISBN:9781337338295

Author:Mitchell

Publisher:Mitchell

Chapter9: Body Mechanics

Section: Chapter Questions

Problem 1RQ

See similar textbooks

Related questions

Q: What are MHC class I and class II receptors and how do they recognize foreignness? This is an…

A: MHC (Major Histocompatibility complex) is a type of transmembrane glycoprotein which are presented…

Q: Provide names of two molecular chaperons and their functions for MHC I antigen presentation pathway

A: MHC class I molecules are comprised of a polymorphic transmembrane heavy chain and a soluble protein…

Q: Lola Fe is 80 years old. She claims that she’s been getting shorter every year, and that soon she’ll…

A: Different bodily changes occurs due to the increase in age. The height is a factor which is…

Q: What is false about the image below? The cells are part of plant ground tissue B) The cells are…

A: * Ground tissue is all tissue in a plant include parenchyma and collenchyma and schlerenchyma. *…

Q: Caspase proteins are enzymes known to play a role in programmed cell death (apoptosis) and the…

A: Caspase is the set of enzymes belonging to protease and they are responsible for the cell with…

Q: What is the significance of the fact that couples who cannot taste PTC never have children who can?…

A: 1. couples who cannot taste PTC never have children who can taste PTC because when we cross between…

Q: 1. One mL of sludge was added to a 99 mL dilution blank. Three 1/10 dilutions were then made. From…

A: CFU/ml represents the number of colony-forming units in the sample. It gives us the estimation of…

Q: Describe ONE likely mechanism of action of a caspase inhibitor. Explain why an inhibitor for…

A: Caspases are expressed inside cells as inactive precursors that must be activated in order to cleave…

Q: Question 8 Why does each cell need DNA? O DNA is used by cells for cell transport DNA determines the…

A: Introduction DNA contains the instructions needed for an organism to develop, survive and reproduce,…

Q: Using punnett square, determine all the possible phenotype of the offspring having parents with the…

A: Given: The blood type of the wife = Type A The blood type of the husband = Type O All possible…

Q: In chapter 8 we read that in tumor cells Rb protein is hyperphosphorylated. In response to that,…

A: p53 suppresses the cell proliferation mediated by the Rb-E2F pathway. Phosphorylation of Rb by…

Q: Discuss different systems of biological classification briefly.

A: In biology, classification is the process of arranging organisms, both living and extinct, into…

Q: If a population is experiencing directional selection with respect to wing color, what type of…

A: Natural selection drives the process of evolution.

Q: Name the cells which are : (i) double negative T cells (ii) double positive T cells

A: T cells are a part of immune system and develop from stem cells in the bone marrow. They protect the…

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 Ib. 3/195 of the F2…

A: Lowest weight = 5 lbHighest weight = 29 lbWeight difference = 24 lb 3/768 = 1/256 Four genes each…

Q: viral and human transcription is different. What molecule is used as a template strand for the viral…

A: Transcription is the process of making RNA copy of a gene sequence. It takes place in nucleus.

Q: differentiate founder effect from bottleneck effect.

A: The two types of genetic drift are founder effect and bottleneck effect. Both, in the form of…

Q: In the US, many farmers regularly use the herbicide glyphosate to keep their fields free from weeds.…

A: Weeds are unwanted plants that grow in fields of particular crops.

Q: Make a simplified schematic representation of the connective tissue cell lineage derived from…

A: The connective tissue cell lineage derived from hematopoietic stem cells and their functions.

Q: How does the concept of a stem cell differ between animal and plant systems?

A: A major difference that lies between plant stem cells as well as animal stem cells is that: plant…

Q: Explaina about pseudopregnant mouse ?

A: Pseudopregnancy consists of two words "pseudo" which means false and "pregnancy" which means…

Q: Describe the white and gray matter regions of the cerebrum, cerebellum and spinal cord. Include in…

A: Introduction The Central Nervous System has two kinds of tissues termed grey matter and white…

Q: Describe the initiation and activation of classical complement pathway.

A: Compliments are a group of thermo labile enzymetic proteins found in the serum and body fluid and…

Q: Worthiness of development 5= very worthy, 1= not worthy at all 5 4 3 2 1 Aspects Reasons Agriculture…

A: Genetic engineering, often known as genetic modifications, is the use of molecular techniques to…

Q: Combining your knowledge of rates of diffusion with yourknowledge of muscle physiology, explain why…

A: Slow-twitch (Type I) fibres, which are characterised by muscles with lengthy contraction duration…

Q: What is the final electron acceptor for aerobic organisms? What does this mean?

A: Aerobic respiration needs oxygen. It is the release of large amount of energy in cells by breakdown…

Q: Which of the following is NOT true regarding the alternative complement pathway? It can be triggered…

A: There are three types of complement pathways: Classical pathway Alternative pathway Lectin pathway

Q: What is the following molecules not required for DNA synthesis during S- phase? * O RNA primer…

A: DNA replication is the process by which new DNA is synthesized from the old DNA. In case of…

Q: Which complement chemotactic component has properties? а. Cla с. C4a d. C5a b. C2a е. Сба

Q: At a high pH the overall charge on a diprotic amino acid is more [ Select ] than the overall charge…

A: The amino acid sequence of a protein can reveals information about its three-dimensional…

Q: Define microevolution.

A: Introduction:- Evolution is the process of a species' features changing over numerous generations…

Q: TRUE OR FALSE? The interdependent evolution of similar organisms whose members freely interbreed in…

A: INTRODUCTION When two or more species evolve together within a time period due to their close…

Q: Explain the mechanism by which action potentials are prevented from being propagated to a…

A: Action potential Is a shift in the resting membrane potential that is immediate, rapid, transitory,…

Q: When SARS-CoV-2 replicates in cells, mutations can occur in the virus’s genome. When mutations have…

A: Mutation The replacement of one nucleotide base with other nucleotide base is known as mutation.

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: 5. Small interfering RNAS, microRNAS and Piwi-interacting RNAS are all classes of small RNA…

A: RNA can be defined as a nucleic acid present in all living cells. It is similar to DNA, but differs…

Q: 14. Which of the following statements describe divergent evolution? * A. Two organisms which live in…

Q: 1. Look again at the six embryos in their earliest stages. Describe the patterns you see. What…

A: Species and their anatomical changes from early stage to late stage. Human : well developed limbs ,…

Q: nucleotides - adenine, guanine, cytosine, and thymine?

A: 1. DNA is made up of long chain polymer of polynucleotide. A nucleotide consist of nitrogenous…

Q: Explain the relationship of osmosis to enzymatic browning in potatoes?

A: Osmosis is the process of diffusion of solvent from the region of low concentrations of solute…

Q: The buzzing of the alarm clock woke Halie. She stretched, yawned, and started to salivate as she…

A: The human nervous system is a "complex network" that includes the brain, nerves, and spinal cord and…

Q: When can the connective tissue's regenerating ability be clearly seen? What type of connective…

A: A cell is the basic unit of life. All living creatures are made up of cells, ranging from…

Q: What biochemical mechanism underlies affinity maturation of the antibody response?

A: Antibodies mediate the adaptive immune response and are produced by plasma cells.

Q: Which molecules, or function groups, or complexes that may be responsible for the absorbance at 595…

A: Spectrophotometry applications are useful to measure the absorbance, reflectance, and transmission…

Q: Turnover of RNA and protein helps to control gene expression by influencing the concentration of…

A: Gene expression is a process in which the genetic instructions of genes are utilized to manage…

Q: What are chimeras ?

A: A chimaera is a person that carries two completely different sets of DNA in their body. Sure, it's…

Q: Distinguish between pure and applied science

A: Science can be defined as the study and comprehension of the natural and social worlds through a…

Q: Given the challenges of human population, climate change, pollution and poverty. How would you…

A: The primary difficulties to economical advancement which are worldwide in character incorporate…

Q: Telomerase contains DNTP molecules as a template for DNA synthesis O True O false

A: DNA( Deoxyribonucleic acid ) is two strand helical structure which serves as genetic material vin…

Q: Which division of meiosis (meiosis I or meiosis II) a. most resembles mitosis? b. cuts the…

A: a.Meiosis II. b. Meiosis I. TELOPHASE I. c. Meiosis I. TELOPHASE I. d.Meiosis I

Concept explainers

Human Movement

Humans can move from one place to another through coordinated movements and postures. The movement produced by the human body due to the contraction of muscles and bending of bone joints is called human movement. Human movements are controlled by the nervous system. Hence, the human movement incorporates the use of muscles, ligaments, joints, and bones. Kinesiology is the field that deals with the study of human movements.

Question

What is body mechanics?
Discuss at least 3 principles of body mechnics

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Arrange the following based on their idea size from largest to smallest CHoices: Kinesiology , Functional Anatomy , Biomechanics Kinesiology ,Biomechanics ,Functional Anatomy Biomechanics , Functional Anatomy , Kinesiology Biomechanics , Kinesiology , Functional Anatomy
Describe how to maintain and use proper body mechanics ?
which of the following apply to movements of the tongue? Give three answers skeletal muscle, spinal nerves, smooth muscle, involuntary control, cranial nerves, voluntary control
what are the basic techniques to study anatomy?in deatil
A neurosurgeon orders a spinal tap for a patient. Into what body cavity will needle be inserted?
One way to keep the body fit and healthy is by means of regular exercise. Im pretty sure we always want to stay healthy. A worthwhile activity we can do during this quarantine period is to be engaged in practical physical activities that can stretch our muscles. We do not need to go to gyms to exercise. We can do them at home. Now, list down sample exercise routines that can be done at home and identify muscles involved in such body movements.
What is similar and what is different between the meanings of the terms biomechanics, human movement biomechanics, and kinesiology?
Why is it important for medical billing and coding specialist to understand medical terminology? What is the difference between anatomy and physiology? Name one of the functions of the muscular system? List at least 2 of the common diseases or disorders of the nervous system?
What is Jumping Rope? What is the procedure of it? What is the benefits of jumping rope?
How long you recommend study and take break in anatomy and physiology? Some good time management skills as a college student you recommend. Thank you :)
After reading Chapter 4, “The Muscular System,” of the Medical Terminology for Health Professions textbook and completing the corresponding MindTap learning lab, answer the following questions: What is the role of the medical assistant in the activity you just completed? Select one (1) of the conditions described in the activity and explain it using layman’s terms.
You need to assist a 60 year old man with weakness in his right lower extremity while performing a standing transfer from his wheelchair to the bed. His other extremities are all strong, and your PT wants you to stabilize his weaker lower extremity. Describe the procedure you will use, the predatory actions you will take, the instructions you will give the patient, and how you will assist with the transfer.