Q: Please answer asap and type your answer and do not copy from anywhere please In a study published in…
A: A keystone predator is one which "prevents a particular herbivorous species from eliminating…
Q: What is the Effect of Castration on Nervous System of the Mammalian Male
A: Introduction Castration is any surgical, pharmacological, or other procedure that causes an…
Q: List down at least five urinary/excretory diseases, their symptoms, and treatment
A: Introduction:- The excretory system is a vital biological component that keeps the human body in a…
Q: fish die-off occurs in a pond near an agricultural field where fertilizer high in N and P has been…
A: Nitrogen, phosphorus and potassium, or NPK, are the 3 essential supplements in commercial…
Q: Humans have employed biotechnology since ancient times to breed animals and improve their crops.…
A: Biotechnology means the branch of science which uses living organisms by combining natural science…
Q: Which color is obtained when protein is treated with Ninhydrin solution? A. Purple B. White C.…
A: In this question we have to describe about protein detection test.
Q: 1. How far should you record and observe any fauna encountered outside the quadrat? Why do you think…
A: Quadrats: Quadrats are simple devices that are highly beneficial in studying the abundance of…
Q: Examine the pedigree which has X linked Dominant inheritance of disorder. Use letter X* (asterisk…
A:
Q: Please answer asap You are caring for a patient with pulmonary (lung) Mycobacterium tuberculosis The…
A: Pathological presentation of infection caused by bacteria Mycobacterium tuberculosis .
Q: 1. The recipient's of organ transplants can acquire some of the behavior and emotional traits of…
A: Neurons have been discovered in important organs like the heart, kidney, and liver. Transferred…
Q: QUESTION 3 DNA methylation O a. You cannot methylate DNA O b. Enhances O c. Represses O d. Represses…
A:
Q: 6a. Complete this flowchart to describe an example of how different versions of a gene can result in…
A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…
Q: Writing a Full Strand: 1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT…
A: DNA It is a nucleic acid which carries genetic information that gets passed from one generation to…
Q: Flatworm parenchyma cells that are stem cells: O A. pigment cells B. fixed parenchyma cells O C.…
A: Introduction Any phylum of flatworms, also known as platyhelminths. Platyhelminthes are a group of…
Q: a. Use a labelled b. Explain how th operon?
A:
Q: 5' UGG CAA UCC UAC GAU 3' < Is it possible for a single base pair substitution to cause a truncation…
A: Yes, it is possible for a single base pair substitution to cause a truncation in the peptide as…
Q: Differentiate histologically the scalp skin and the palm skin. Include all the histological…
A: Skin is the largest and heaviest organ of the body. It consists of three main layers; the epidermis,…
Q: The lungs perform other :physiologic functions Play secondary role in heat exchange and fluid…
A: The lungs are a crucial organ of the body. They are quite spongy and are filled with air with the…
Q: 14. Which of the following trees of life (showing Archaca (A), Bacteria (B), and Eukarya (E)) best…
A: Evolution is a continuous process .
Q: Gene flow can have one effect in the context of a single population, and a different effect in the…
A: Gene flow is the movement of genes or alleles between populations separated by geography. The…
Q: What are B and T cells and how do they relate to lymph nodes? 2. What are cell-surface antigens? How…
A: Introduction:- The remarkable specificity of adaptive immune responses is due to lymphocytes.…
Q: In 5 sentences only, What are restriction enzymes (RE)? Describe how a RE can be used to…
A: Researchers continue to find new medications that aid in the treatment of deadly diseases and enable…
Q: is/are performed by consumers, and equation(s) is/are performed by producers. a. I; II b. II; I c. I…
A: All organisms on earth require input of energy from its environment. we know that son is the source…
Q: Select the correct answer for each question. Explain why you chose that answer as opposed to the…
A: The vagus nerve is the tenth cranial nerve which is also the longest mixed cranial nerve. It carries…
Q: In X-Linked Dominant disorder, a gene responsible for a genetic disorder is located on the X…
A: X-linked dominant inheritance is the genetic conditions associated with mutations in genes on the X…
Q: What happens to the size of cells as the cell number increases? Do they get bigger or smaller in…
A: Cell Growth: Cell growth is defined as an increase in a cell's total mass, which includes the volume…
Q: A. For each of the following nucleotide sequences, determine the amino acid sequence. 1. 5'…
A: Introduction Amino acids are molecules that combine to form proteins, They build muscles, prevents…
Q: 2. ratio b. a part of a whole 3. rectal drugs c. comparison of two numbers 4. Body Surface Area…
A: h. Dosage-per-kg- of body weight d. Used in writing fractions a. medication prepared for insertion…
Q: Most land animals with exoskeletons are smaller than the volume of a mouse, and most vertebrates are…
A: Insects belong to the phylum Arthropoda and it is the largest phylum in the animal kingdom…
Q: What is the function of a helper T cell? OA. to destroy cells that are already infected OB. to…
A: Helper t cells are helpful in adaptive immunity in our body. These cells recognise foreign antigens…
Q: In the presence of lactose and the presence of glucose the lac operon is not expressed Lacl is bound…
A: Introduction:- Lactose metabolism genes are found in the lac operon of E. coli. It is only expressed…
Q: Epigenetic changes in chromatin remodelling which selectively PREVENTS transcription Acetylation…
A: DNA is the store house of genetic information. This genetic information is expressed as protein…
Q: Which ecosystem has the least biodiversity?
A: Biodiversity where all the different kinds of life found in one area—the variety of animals, plants,…
Q: e. None of these 8. An earthquake hits the bay area, and you and your family have the choice of…
A: b. eat chicken then the beans beacause chiken can't be stored for longer days in earthquake…
Q: 13. Directional selection means that a. The environment controls which organisms will survive. b.…
A: Introduction Selection:- It is the preferential survival and reproduction or preferential…
Q: There are many different sources of biomass and many ways of harnessing energy from biomass. Discuss…
A: Introduction The exponential rise in population and in increasing demand for food and fuel lead us…
Q: Q12: E is not the correct answer, what is the correct answer Flatworm parenchyma cells that are stem…
A: Flatworms, also known as flatworms, Platyhelminthes, or platyhelminths, are a phylum of bilaterian,…
Q: Heparan sulfate proteoglycans appertain to which of the following processes?* a. transport by…
A: Heparan sulfate proteoglycans are the extracellular matrix proteins. These are basically the…
Q: 7. A 24-year-old schizophrenia patient with prominent cognitive symptoms and social impairment is…
A: Schizophrenia It is a condition when a person is unable to think, behave, speak, feel or respond…
Q: Question 13 Staphylococcus aureus toxin responsible for symptoms associated with food poisoning is…
A: Staphylococcus aureus is a Gram-positive round-shaped bacterium.
Q: Give the chromosome number for the following: 1. 2n=4 treated with colchicine to produce an…
A: Every organisms have different chromosomes number. In human chromosome number is 46 , it is varies…
Q: The following table shows the number of dogs for certain tail lengths in a population of dogs. Tail…
A: A trait is a characteristic features that is unique to particular individual . A trait can follow :-…
Q: Now consider the illustration above that shows data on how often white fronted bee eater birds will…
A: Hamilton's rule The rule states that altruism is observed between organisms that are closely…
Q: QUESTION 1 You are studying a mutant strain of e.coli. When you add lactose to the media of this…
A: Lac operon is the segment of DNA which is involved in the breaking down of lactose into glucose in…
Q: . In animals, cytokinesis occurs in which of the following phases of mitosis? a. Telophase b.…
A: Introduction: Cytokinesis is the literal division of a cell, which occurs in both mitosis and…
Q: Biology ex. Locate any woodland or forest area close to your home. Create a 10 x 10 m quadrat once…
A: Information gathering and literal search are usually done in research processes. It is the process…
Q: Which of the following is the correct path of airflow during inhalation? O nasal cavity, larynx,…
A: Breathing is the most important physiological process through which an organism takes in the…
Q: To determine: informational on the rate of horizontal gene transfer. Whether the complexity of or…
A: Gene transfer refers to the transfer of genetic information from one cell's genes to the genes of…
Q: +1 1 4 6. 7 8 9. Transcriptional stop sequence +1 ТАTA box ATG ТАА AUG UAA Here is a diagram of a…
A: A base pair is two nucleotides that together constitute DNA ladder." A DNA nucleotide is composed of…
Q: . Differentiation of the Spemann’s primary organizer requires which of the following?* a.…
A: Spemann’s primary organizer are the transplanted tissue of early gastrulas and its dorsal lip used…
1. Trithorax group proteins silence genes by*
Step by step
Solved in 2 steps
- 4. Gene expression in mammals can be increased by which of the following mechanisms? A. X-chromosome inactivation (as in the case of the female tortoiseshell cat) B. histone demethylation C. histone methylation D. histone deacetylation E. histone dephosphorylation 5. Which of the following DNA components is found on the exterior of this double-stranded molecule? A. the nitrogenous bases B. the pyrimidine bases C. the ribose sugars D. the purine bases E. the phosphatesWhich of the following does NOT pertain to the myoblast-determining gene 1?*a. It is a master gene.b. It is a silencing gene.c. It produces a transactivating protein.d. It activates its own gene. Gene silencing involves which type of histone modification?* a. acetylation of histone 4 b. dimethylation of histone 3 c. trimethylation of histone 4 d. trimethylation of histone 3 Given the required environment, the totipotency of the nucleus can allow which of the following?* a. a committed cell to undergo dedifferentiation b. a committed cell to undergo terminal differentiation c. a terminally differentiated cell to produce a complete organism d. a terminally differentiated cell to produce specific types of tissues An induced pluripotent cell is described by which of the following?* a. It is a committed cell that undergoes redifferentiation. b. It is a committed cell that undergoes dedifferentiation. c. It is a terminally…Table of the Standard Genetic Code Middle base 5'- C_-3' UCU Ser (S) |UAU Tyr (Y) UCC Ser (S) UAC Tyr (Y) UCA Ser (S) UCG Ser (S)UAG Ter CCU Pro (P) CAU His (H) CCC Pro (P) CCA Pro (P) CAA GIn (Q) CCG Pro (P) CAG GIn (Q) 5'- _U -3' 5'-_A_-3' 5'-_G_-3' 5'-U_-3' UUU Phe (F) 5'-U_-3' UUC Phe (F) 5'-U_-3' |UUA Leu (L) 5'-U_-3' UUG Leu (L) 5'-C_-3' |CUU Leu (L) 5'-C_-3' |CUC Leu (L) 5'-C_-3' CUA Leu (L) 5'-C_ -3' CUG Leu (L) UGU Cys (C) 5'-_U-3' 5'-_C-3' 5'-_A-3' UGG Trp (W) 5'-_G-3' 5'- U-3' 5'-C-3' 5'-_A-3" 5'- G-3' 5'- U-3' 5'-_C-3' 5- А-3' 5'-_G-3' GCU Ala (A) GAU Asp (D) GGU Gly (G) 5'-_U-3' 5'-C-3' GGA Gly (G)5'-_A-3' GGG Gly (G) 5'-_G-3' UGC Cys (C) UGA Ter UAA Ter CGU Arg (R) CGC Arg (R) CGA Arg (R) CGG Arg (R) ACU Thr (T)|AAU Asn (N) AGU Ser (S) AAC Asn (N) AGC Ser (S) AGA Arg (R) AGG Arg (R) CAC His (H) 5'-A_-3' |AUU lle (1) 5'-A_-3' AUC Ile (1) 5'-A_-3' |AUA lle (1) 5'-A_-3' |AUG Met (M) ACG Thr (T) AAG Lys (K) 5'-G_-3' GUU Val (V) 5'-G_-3' GUC Val (V) 5'-G_-3' GUA Val (V)…
- 1.This is where the RNA polymerase is bound and a short region of DNA is accessible to begin the process of transcription. Group of answer choices a. Closed Promoter Complex b. Open Chromatin c. Closed Chromatin d. Open Promoter Complex 2.The nucleotide near the 3' splice site of an intron that joins with a Guanine located at the 5' splice site by a 2'-to5' phosphodiester bond is called the: Group of answer choices a. Branch Point Adenine b. Branch Point Thymine c. Branch Point Uracil d. Branch Point Cytosine 3.The form of chromatin in which histone 1 partially condenses chromatin fibers into a coiled form is called: Group of answer choices a. 10 nm fibers b. Heterochromatin c. 300 nm fibers d. Solenoid 4.Exchange of genetic information between homologous chromosomes. Group of answer choices a. Homologous Recombination b. Gene Flow c. Gene Conversion d. Homologous Repair17. NF1 protein Ras signaling. ---- a. activates b. inhibits 18. The deacetylation of the histones results in converting the chromatin from a configuration favoring transcription. a. True b. False 19. Gene conversion occurs because a. DNA polymerase temporarily switches from its original template strand to the complementary DNA strand. b. recombination occurs between nonhomologous chromosomes. c. there occurs a second mutation due to environmental effect 20. Proteins in a signal transduction pathway find and bind to each other due to their -- domain. a. SH1 b. SH2 c. SH31. Which of the following conditions will result to deactivation of a gene? a. histone methylation b. phosphorylation of a transcription factor c. binding of hormones to its nuclear receptor d. deactivation of transcription factor inhibitory protein 2. Direct complementarity of the microRNA to the target mRNA will lead to a. mRNA degradation b. inhibition of transcription c. chromatin remodeling d. inhibition of translation
- 1. How would the following affect BOTH transcription and translation of a particular multi- exon gene in a eukaryotic cell (for each address both transcription and translation of a particular multi-exan gene; also treat each independently): A mutation abolishing kinase activity in TFIIH a. b. A mutation abolishing mRNA binding in the snRNP U1 С. A mutation in aminoacyl tRNA synthetase for isoleucine such that it can't bind ATP (assume there is an isoleucine in the code)1)A. how do you read a sequence of DNA (template or non-template strand) to convert it an mRNA sequence and to a protein? B.How does chromatin remodeling regulate gene transcription? C. What are the major differences between gene expression in bacteria and eukaryotes D. How are non-coding regions involved in gene transcription? E. Explain how eukaryotic genes sometimes produce multiple protein products?3a. Select all the correct types of RNA that are both the product of transcription and are also translated in the cytoplasm. ☐ snRNAs ☐ pre-tRNAs ☐ rRNA ☐ tRNA ☐ miRNA ☐ mRNA 3b. The ribozyme found in the ribosome catalyzes ... (which of the following?) a. the synthesis of pre-mRNA as part of the transcription process. b. the formation of the peptide bond. c. the association between the large and small ribosomal subunits. d. a reaction that uses RNA as a substrate.
- 4. For the gene drawn below, transcription begins at the boxed A/T base pair. a. Identify the promoter, template and coding strand. b. Transcribe c. Translate 5'- TTGGAATTGTGAATGGATAACAATGTGACACAGGAAACAGCTAAGTAGATGTTT -3' 1 54 3'- AACCTTAACACTTACCTATTGTTACACTGTGTCCTTTGACGATTCATCTACAAA -5' ---+--- ---+--- ---+---- ---+--- ---+---1. In a couple of sentences, explain how eukaryotic activator proteins (that are usually gene-specific transcription factors) can enhance transcription even when bound to sequences hundreds or thousands of nucleotide pairs away from a gene’s promoter. 2. Describe three common characteristics of transcription factors. The characteristics may relate to structure, or mechanism of action (PLEASE ANSWER BOTH PLEASE)7. Explain why a mutant Ras is an oncogene causing many human cancers