Sequence the steps to transfect and observe a fluorescent protein in a slice of the brain:

Q: Is it important to have fewer phages than bacterial host cells when doing a quantitative plaque…

A: A virus is an infective agent, which is sub-microscopic in nature. It has the capability of…

Q: Mistakes may happen during every copying process. The same is true for DNA replication. Are there…

A: The process of replication of DNA is highly accurate. However, there are chances of occasional…

Q: he Escherichia coli cell infected by the phage codifies for the optimized ligand when the phage DNA…

A: A viral ligand is a receptor in which the viruses function as specific ligands and bind to the…

Q: What conditions are making bacteria competent to taking up a foreign plasmid? Please answer asap

A: Natural genetic competence is the ability of cells to bind and taken up exogenous DNA. It is…

Q: Using the 5 major steps (isolation, cutting, ligation, transformation, colony screening), make your…

A: 1.  Isolation of a specific gene from donor e.g. human  cells broken open Genetic probe added…

Q: RT-PCR can determine the amount of mRNA for a particular gene in two different growth conditions.

A: Reverse transcriptase polymerase chain reaction (RT-PCR) is a laboratory technique combining…

Q: You have found that two types of bacteria (one large, one small) can undergo horizontal gene…

A: Bacteria are small single cell organisms. They found everywhere on earth. Some of them can survive…

Q: Describe the similarities and differences between abacterial chromosome and a plasmid

A: Deoxyribonucleic acid can be defined as a molecule that is composed of two polynucleotide chains…

Q: You generate several temperature sensitive mutant strains of bacteria. To study what genes might be…

A: Introduction :- Bacterial mutants frequently lose a growth characteristic (such as the inability to…

Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…

A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…

Q: The ____ plasmid contains genes for synthesizing connections between donor and recipient cells.

A: The plasmid is defined as a small, circular, extra-chromosomal, double-stranded DNA molecule present…

Q: Using the figure below briefly explain how recombinant lentiviral particle can be formed.

A: The figure shows a diagram in which there is a recombinant lentiviral particle that is composed of…

Q: prc nt'

A: Scientists use the PCR (polymerase chain reaction) technology to amplify small amounts of RNA from…

Q: How can we steralize Animal cell in culture?

A: Sterlisation is the process of removal of any microorganisms present in vegetative or spore form.…

Q: transformming  E. coli by inserting a plasmid what new characteristic is acquired

A: The process through which the genetic composition of a cell is changed by the incorporation of an…

Q: Describe how genetic transfer can explain the growth of colonies on the middle plate.

A: A nutrient agar plate is a plate with the agar media having all the nutrients required for the…

Q: Jm109 cells transformed with ligation and plasmid alone is used. The colonies most like:   white…

A: β-galactosidase is an enzyme encoded by the lacZ gene and is used to break down lactose to glucose…

Q: A gene was being ligated to the plasmid vector to prepare a recombinant DNA during bacterial…

A: BASIC INFORMATION  RECOMBINANT DNA TECHNOLOGY  It is formed by attaching the genome of species which…

Q: Agraobacterium mediated transformation is a useful gene transfer technique but still we can’t use…

A: Agrobacterium species harboring tumor-inducing (Ti) or hairy root-inducing (Ri) plasmids cause crown…

Q: What is blue/white screening? What is the key feature of a plasmid that is used for it?

A: The blue-white screen is a screening technique that allows for the rapid and convenient detection of…

Q: E.cor1 is aa) DNA ligase enzymeb) Restriction endonucleasec) A vector used for insulin synthesisd) A…

A: Bacteria are member of large group of unicellular microorganisms. Bacteria have cell walls, but lack…

Q: To maximize the number of mutations following UV irradiation, should you incubate the irradiated…

A: A mutation is a modification that happens in the deoxyribonucleic acid (DNA) sequence, either due to…

Q: The properties that all plasmids share are that they1. all carry genes for antimicrobial…

A: Plasmids are extrachromosomal nucleic acids that are found generally outside the host's genetic…

Q: Explain the features of commercially prepared plasmids ?

A: Plasmid play a critical role , specially in the area of genetic engineering , such as gene cloning ,…

Q: Describe how, using mice, a researcher could carry out (1) organismalcloning, (2) production of ES…

A: Cloning is the method by which an organism is created by the cells derived from a parent organism.…

Q: How does restriction enzyme digestion allow for the determination of the correct plasmid construct…

A: Restriction enzymes are proteins that cut DNA at specific sequences. These enzymes are found in…

Q: Briefly describe two different methods for inserting foreign DNA into plasmids, giving the strengths…

A: The plasmid is typically a small circular deoxyribonucleic acid (DNA) strand in the cytoplasm of the…

Q: Why does the probe bind to a specific site on a chromosome?

A: Cell division is the process by which a cell divides into two daughter cells. During this process,…

Q: One of the frist steps in isolating plasmid DNA via mini-prep is to pellet the cells after O/N…

A: 1) The use of Resuspension buffer in the extraction or the isolation of the plasmid from the DNA is…

Q: Plasmids are important for recombining DNA.   B.) What are the requirments of an expression…

A: Plasmids: They are small, circular, double-stranded DNA naturally occurring in bacterias and some…

Q: propose a method with the help of which they can generate many copies of the gene.

A: The production of multiple copies of a gene from a single gene, this technique is called as DNA…

Q: In a transformation experiment, a sample of competent bacteria was mixed with a plasmid containing…

A: In a bacterial colony some bacteria are resistant to an antibiotic and some are susceptible.…

Q: Bacterial systems serve as an excellent model to express proteins but has a disadvantage – what is…

A: Expression of genes: Gene expression is the process of a gene being translated into a functioning…

Q: distinguish between bacterial cells that obtained the plasmid and those that did not

A: Bacteria are single celled organisms with a unique internal structure.

Q: What is pGLO plasmid? How has it been engineered so that the cells that carry it can be detected?…

A: The examination of genes and inheritance, or how specific characteristics or traits are transferred…

Q: Which of the following statements is true of plasmids? A Agrobacteria use plasmids to induce tumors…

A: Options - 1, 2, 4, 5, 6  are true

Q: You have constructed a cDNA library in a phagemid vector. Describe how you would screen the library…

A: Phagemid vectors are plasmid DNA [Deoxyribonucleic acid] containing a small portion of the genome of…

Q: Write in detail about the effects of presence as well as absence of MCS and reporter gene in a…

A: MCS (Multiple Cloning Sites ) -- Multiple cloning site is region of D.N.A. with in a plasmid that…

Tissue regeneration & repair

Tissue regeneration involves the restoration of tissue components by regrowth of damaged tissues. In contrast, tissue repair involves patching of injured tissue rather than restoring it. It is the proliferative capacity of the cells that decides the amount of regeneration against the repair that would occur in the tissue. Both regeneration and repair depending on the duration of the injury and response to the inflammation.