Select the two most hydrophobic amino acids. A. Leucine and Isoleucine OB. Arginine and Lysine OC Cysteine and Methionine D. Alanine and Glycine E. Glutamine and Asparagine

Q: Draw simple peptides from individual amino acids, and label the N- and C-terminal amino acids

A: Amino acids are the simplest building blocks found in proteins. They are linked together by amide or…

Q: Which component of an amino acid confers its uniqueness with respect to other amino acids? In other…

A: Introduction  The chemical substances known as amino acids are what make up proteins. They are made…

Q: Draw the amino acids serine and threomine bonded together with a petide bond.

A: Amino acid

Q: What are some differences between the followingpairs? a. secondary and tertiary proteinstructures…

A: Proteins are composed of amino acids attached in a linear form through peptide bonds. Twenty…

Q: classification of amino acids.

A: Amino Acids are the building units of proteins linked together by "Peptide bond". There are about…

Q: What distinguishes d-amino acids from lamino acids? What biological functions do peptides containing…

A: Amino acids are organic molecules, which act as the building blocks of proteins. Amino acids are…

Q: Which of the following can be used to treat phenylketonuria? Select one: O a. • a diet rich in…

A: Phenylketonuria is a genetic condition that causes a buildup of the amino acid phenylalanine in the…

Q: You have isolated this peptide. AÇQGRKSPWTT TAHEVYPGGCMN What products would you get if you treated…

A: The agents given in the question are the agents which cleave the peptide at certain amino acid…

Q: Describe the linkages between amino acids that form polypeptide chains.

A: Proteins or polypeptides are end products of the gene expression process. These biomolecules are…

Q: Differentiate the following: a. Essential and non-essential amino acids b. Single and conjugated…

A: Since you have posted a question with multiple sub-parts, we will solve only first three sub-parts…

Q: efer to the figure below. Replacing lysine with another amino acid in the protein may alter the…

A: Proteins: Proteins are an important class of biological macromolecules that are polymers of amino…

Q: How would the substituted amino acid (Cysteine) interact differently with the neighboring amino acid…

A: Cysteine is one of the few amino acids that contains sulfur. This allows cysteine to bond in a…

Q: Describe how two amino acids are combined to form apolypeptide.

A: The translation is the process of building the polymers of protein where the amino acids sequence…

Q: Identify the biomolecules being described. (Proteins, nucleic acid, carbohydrates, lipids). A. It is…

A: Biomolecules are organic molecules produced by living organisms and includes small molecules such as…

Q: 1. Classify the 20 common amino acids A. According to type of side chain, R group a. Neutral amino…

A: Each amino acid has a N-terminal (-NH2 group), a C-terminal (-COOH group) & a R-group or the…

Q: amino acids vary from each other in their a. amino groups b. side chains (R or variable groups)…

A: Introduction :- Amino acids are the building blocks of proteins and they are composed of three…

Q: Metalloprotein linkages are most likely to be formed between: a.Two cysteines b.An arginine and a…

A: Metalloprotein linkages are most likely to be formed between?

Q: For each amino acid: [1] give the name; [2] give the threeletter abbreviation; [3] give the…

A: Amino acids are monomers that make up proteins. Amino acids have an amino group and a carboxylic…

Q: Bile salts are synthesized from: a. Cholesterol b. Prostaglandin c. Triacylglycerol d. Ceramide

A: Introduction: Bile acids are steroid acids present mainly in mammals and other vertebrates' bile.…

Q: Match the amino acid description with their 3-letter abbreviation…

A: Amino acids can be polar, non-polar, positively charged or negatively charged, depending on their…

Q: Which of the following is NOT true of a common fatty acid represented by all cis-20:5 A5? A. The…

A: Hi dear, here's your answer what you want. Can you please give me an upvote for this answer.…

Q: Which of statement/s is/are true?  Palmitoleic and oleic acids are unsaturated fatty  acids…

A: Fatty acids are the building blocks of fat in our body. Depending on the structure they are of two…

Q: Explain how it is feasible to modify an amino acid inside a protein without affecting its function.

A: Proteins are one of the body's most significant macromolecules. These are made up of amino acids…

Q: The amino acid that does not contain a cyclic ring. a. proline b. threonine c. tyrosine

A: All proteins or peptides present in the cell are composed of twenty standard amino acids. Each amino…

Q: Write the structure, identify the R groups and describe the chemical properties of these amino…

A: The very first thing to point out of the above question and it is Sucrose. Sucrose is not the Amino…

Q: When the amino acid sequence of Hb and Mb is compared, some of them are found to be the same…

A: Hemoglobin and myoglobin are oxygen binding proteins. Hemoglobin helps to carry oxygen from lungs to…

Q: Which of the following is incorrect about the peptide Val-Leu-Ala-Ser-Gly? It has a net charge of…

A: H3+N-Val-Leu-Ala-Ser-Gly-COO- a) We have 1 positive charge at the N-terminal and one negative charge…

Q: Tyrosine is a nonessential amino acid in humans. Under what circumstance would it become an…

A: Amino acids are biomolecules serving as the building blocks of proteins. These have a carboxylic…

Q: amino acids can be polar neutral, polar folded protein in the aquEous cellular environment, is…

A: The four non-covalent interactions that stabilize the structure of a protein are: hydrophobic…

Q: A. Name 3 nonpolar amino acids found in proteins (give name and 3 letter code)   B. Name 2 polar…

A: A) Non-polar amino acids: The side chain comprises mostly of hydrocarbons. B) Polar uncharged amino…

Q: Use the one letter code to give the sequence of this peptide

A: A polypeptide is a chain structure, which is comprised of several amino acids. All these amino acids…

Q: What are the 2 main categories of proteins? B. What are the features of protein in these categories

A: As per the central dogma of biology, the genetic information stored within the DNA is transcribed…

Q: Draw amino acids Methionine, Phenylalanine, Valine, and Phenylalanine

A: Introduction: Amino acids are organic compounds that contain the functional groups amino (–NH2) and…

Q: Which of the following sets corresponds to nonpolar amino acids? a. Met, Ile, Glu b. Ala, Leu, Trp…

A: Amino acids are α-amino carboxylic acids that are the basic building blocks of proteins. Amino acids…

Q: Denaturation of protein is a result of OA. cleavage of the peptide bond B. formation of H-bond O c.…

A: Proteins are made up of polypeptide chains, which are nothing but the sequence of amino acids…

Q: Create a mind map for amino acids.

A: Amino acids - are building blocks of proteins and alpha carbon of amino acids contains amine group,…

Q: : Out of the following, is a semi-essential amino acid. A. Methionine B. Tryptophan C. Leucine D.…

A: Amino acids can be divided into essential, semi essential and nonessential.

Q: Identify what GalNAc, GICNAC, Fucose and Sialic Acid are, draw them and describe their function/role…

A: Carbohydrate derivatives perform many important biological functions in living systems. Few among…

Q: Consider an amino acid sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: Which of the following pairs of amino acids stabilizes a fold in a polypeptide chain through ionic…

A: Proteins are composed of a linear chain of amino acid sequences attached via peptide bonds. Proteins…

Q: Define the following terms: a. β-hairpin b. supersecondary structure c. fibrous protein d. globular…

A: Note- Since you have posted a question with multiple subparts, we will solve the first three…

Q: Which of these amino acids is a polar, uncharged amino acid? (Select all that apply, if necessary.)…

A: Amino acids are defined as the organic compounds that have amino (-NH3) and carboxylate (-COO- )…

Q: List 10 essential amino acids in humans. Why are theyessential?

A: Amino acids are classified based on the need in living organisms into three types and they are…

Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…

A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…

Q: Define the following terms:a. moonlighting proteinb. fibrous proteinc. globular proteind. prosthetic…

A: Disclaimer: Since you have posted a question with multiple sub-parts, we will solve first three…

Q: The ff. are neutral amino acids, except: O A. methionine OB. lysine O c. threonine OD. non of these

A: In a amino acid there are 4 different groups attached to the carbon atom that is a carboxyl group,…

Q: Amino acid sequence in a protein that can form N-glycosylation is called a glycosylation sequon.…

A: Glycosylation is the covalent addition of carbohydrates to proteins. The proteins to which specific…

Q: Draw the formula of each of the following: a. Aspartic acid-histidine-tryptophan b.…

A: Hi! Thanks for your question. As you have posted multiple questions we are answering only the first…