Restriction digestion of DNA fragments is not sequence specific. True False
Q: Self-splicing introns are called ribosomes splicing enhancers ribozymes intron silencer
A: Self splicing introns : These can catalyze their own excision from the mRNA, the tRNA, rRNA…
Q: Match the non-Mendelian genetic terms with their descriptor. Genetic and environmental factors…
A: Genetic and environmental factors collectively influence a phenotypic expression Answer-…
Q: Different types of mutations and how to use the genetic code table.
A: Mutations are described as the changes that occurs in the sequence of DNA. Mutations can occur from…
Q: value the cathode or anode). Protein eins wards Pepsin Lysozyme Hemoglobin Mynolohin IpH 1.0 11.0…
A: On basis of the gel used, electrophoresis is classified into 2 types, Agarose gel…
Q: Explain the term ‘buffer capacity’.
A: An aqueous buffer solution is made up of a weak acid and its conjugate base, or vice versa. When a…
Q: 2. Explain the difference between saturated and unsaturated fats.
A: Fats often refers to triglycerides which is esters of glycerol and fatty acids. One glycerol can be…
Q: . Using electron flow arrows, show electron transfer from nadh to fmn in complex 1 of the electron…
A: The electron transport (ETC) chain is coupled with ATP synthesis. ETC occurs in Cristea…
Q: heat the samples. Would increasing the concentration of acid in the solution, in lieu of heating,…
A: In Barfoed's test heating is used to break the bonds between the disaccharides forming…
Q: considering mating a black hearing male Labrador dog (homozygous in both alleles) with black deaf…
A: According to the given question, the male is black hearing Labrador dog and is a type of a…
Q: What is a Ramachandran Plot?
A: Ramachandran plot is developed by G N Ramachandran, C Ramakrishnan and V Sasisekharan in 1963. This…
Q: Calculate the Keq (report up to two decimal places and do not use scientific notation) for the net…
A: The energetically unfavorable reactions having a positive delta G value is made possible ein the…
Q: Fluorescent proteins like the green fluorescent protein (GFP) found in jellyfish are a class of…
A: Proteins are composed of different types of amino acids (polar charged, polar uncharged, and…
Q: Which among the following The colored solution formed as a positive result for the Biuret test is…
A: A polypeptide chain has amino acids linked together by a peptide backbone.
Q: Determine the amino acids that compose the peptide shown below.
A: Amino acids are compounds with a carboxyl group and amino group attached to the same carbon atom.…
Q: What is the relationship between the cooling of organs and tissues for medical transplants and the…
A: For patients with end-stage disease, organ transplantation is the most effective therapy. Donor…
Q: D Question 6 6. The following table summarizes properties of three different proteins. Two would be…
A: Chromatography is an analytical technique for separating components of a mixture
Q: Why is understanding reaction rates significant? Indicate at least 3 key importance of understanding…
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…
Q: II. GENERAL INSTRUCTIONS Answer the following items. 1. Give an example of a catalyst and its…
A: Tri carboxylic acid cycle or the citric acid cycle, TCA cycle or the Krebs cycle is a series of…
Q: An individual developed a condition characterized by progressive muscular weakness and aching muscle…
A: This shuttle functions in the transporting the fatty acids present in the cytosol to the…
Q: On the right the Hill plot com- (b) pares the O2 binding properties of Hb Ya- kima with those of HbA…
A: The Hill plot given in the diagram shows the allosteric regulation and affinity of the different…
Q: Can you please briefly describe the reaction mechanism that permits the detection of reducing sugars…
A: Fehling's reagent is a reagent commonly employed in differentiation of water soluble carbohydrates…
Q: Basing off of the structures of monosaccharides, explain how a simple sugar can nucleophile. You may…
A: Electrophiles are electron deficient groups. Nucleophiles are electron rich groups.
Q: What's the length of the DNA around histone core in a nucleosome? 50 base pairs 146 base pairs 8…
A: Nucleosome:- Histones are responsible for the first level of DNA packing and most basic level of…
Q: In Lieberman's Test, what should you do to revert the change caused by the addition of water to the…
A: Liebermann's test is a confirmatory test for the detection of a phenol group. It is also employed in…
Q: 1. Calculate the overall AG°' (reported up to two decimal places) for the net reaction. kJ/mol 2.…
A: In biological systems, a thermodynamically unfavorable reaction with a positive Delta G value is…
Q: Is proteus vulgaris positive or negative in lia test? Why?
A: Proteus vulgaris is a gram negative bacteria that test positive for indole and catalase production.…
Q: (Q39) A mutation in a certain protein results in the presence of a cysteine residue (rather than the…
A: Answer 39) A mutation is considered as a change in a DNA sequence. Mutations can easily result from…
Q: Which of the following statements are correct? Explain your answers.A. An atomic nucleus contains…
A: Since the atom and nucleus were discovered. The bonding of a proton and a neutron, a proton and a…
Q: 6. With the presence of fast-food chains, many people have the opportunity to «have a quick bite…
A: Fast foods are rich in carbohydrate, saturated fats and also contains some preservatives. Along with…
Q: Which of the following statements are TRUE? Multiple answers are accepted for this question a .Two…
A: Two answers are correct
Q: Which of the following are nonessential amino acids in humans? valine aspartic acid proline…
A: Amino acids are monomers of protein they are linked with each other by forming peptide bonds.…
Q: Calculate the free energy change for glucose entry into cells when the extracellular concentration…
A: Free energy change The change in free energy (ΔG) is basically the difference between the heat…
Q: The following structure is D-sorbose. Which reagent will oxidize D-sorbose? CH2OH C = 0 Н-С-ОН НО -С…
A: Sorbose is a ketose belonging to the group of monosaccharides
Q: COO co0 C=0 C=0 + CH2 ČH3 COO The name of enzyme that catalyzes above reaction is Select ] and the…
A: Here, a reaction is given in the question and we have to identify the enzyme which catalyzes this…
Q: Amino acids with non-polar side chains are zwitterions at a. middle pH levels, between the pKa’s of…
A: Amino acids are compounds with an amino group, a carboxyl group, a hydrogen atom, and a variable…
Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…
A: Steps in Prokaryotic Translation Initiation: GTP bond Initiation factors (IF1-3) binds to 30S…
Q: What are the steps in extracting DNA from a Banana using simple household materials like dishwashing…
A: DNA extraction from banana is most commonly followed as banana is triploid with three sets of…
Q: Consider the analogy of the jiggling box containing coins that was described on page 85. The…
A: When we face a situation where rate of forward reaction is euqal to the rate of backward reaction…
Q: please name and characterize the enzym class according to the given rraction C=O 0. CH ČH-OH C=O Ó.…
A: The given molecule is fructose-1,6-bisphosphate which is broken down to glyceraldehyde-3-phosphate…
Q: In the majority of cases, amino acid catabolism can be broken down into a two-step process;…
A: The catabolism of the amino acids begins with the removal of the amino group. The amino group can be…
Q: RBC metabolism pls explain as simple
A: RBCs are metabolically active , complex cells that used up glucose in order to generate ATP or…
Q: Draw the two amino acids serine and alanine, and a dipeptide that could be formed by combining these…
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: Basic structural component of Lipids, Protein and Enzymes?
A: A biomolecule, sometimes called a biological molecule, is any of the numerous chemicals produced by…
Q: how allosteric regulation is fundamentally different from competitive/uncompetitive/mixed inhibition…
A: Some categories of enzymes exhibit kinetic properties that cannot be studied using Michaelis-Menten…
Q: Can you please briefly describe the reaction mechanism that permits the detection of reducing sugars
A: One of the three major nutrients is carbohydrates. Sugar is a common name for them. They can be…
Q: Which polymerase transcribes genes with internal control regions (ICR)? O RNA Pol I RNA Pol III RNA…
A: The eukaryotic cells have three distinct RNA polymerases that transcribe different sets of genes.
Q: . ) In one (1) sentence point out a key structural similarity and difference in each of the…
A: Nucleic acids are constituted of nucleotides linked via phosphodiester linkages while proteins are…
Q: How does the liver maintain a safe level of blood glucose during a normal 24-hour day?
A: The liver serves as the body's glucose or fuel reserve, assisting in the maintenance of steady and…
Q: For carbohydrates to be converted to energy, it undergoes the process of metabolism, where in the…
A: Carbohydrates are major energy source of human beings. It is most important component of our diet .…
Q: Arginine is considered a basic amino acid because its side chain ________ at physiological…
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines…
Step by step
Solved in 2 steps
- Enzymes of bacterial origin used in a wide variety of techniques are: ligases restriction endonucleases primase dna polymerase resctriction exonucleaseRestriction enzymes are referred to as "molecular scissors", justify thatRestriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’
- Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHIPCHEM4321. An agarose gel electrophoresis pattern of the plasmid PSPM4321 digestion (restriction) is shown below. Draw a restriction map of a plasmid with the appropriate restriction sites based on the data given below. Hindlll Hindll BamHI +BamHI Figure 1: 1% agarose gel electrophoresis of pCHEM4321 40 24 16 12 12 8 4 4 + |DNA scissors used in genetic engineering applications are called Endo nucleases Restriction enzymes Exo nucleases O DNases
- A linear DNA fragment and a plasmid has three restriction sites for EcoRIhow many fragments will be produced from linear DNA and plasmid respectively.B. Restriction Mapping. Single and double digestion of plasmid pMCS326 were performed using the restriction enzymes Alulll and EcoRV. DNA fragments are shown in an electrophoretogram below. Construct a restriction map of plasmid pMCS326 for enzymes Alulll and EcoRV. 20 kb 11 kb 8 kb 6 kb kb 3 Alulll + Alull EcoRV ECORV | || Restriction Map:Polymerase chain reaction cannot amplify complete circular plasmids. True False
- | Choose ) [Choose ) electroporation restriction fragments sticky end expression vectorIn biotechnology procedures, a(n) ____ is a nucleic acid fragment that is used to search for and identify a sequence of interest. vector probe library antibody plasmidWrite TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.The primosome complex includes primase, helicase and gyrase. 2.In plasmid DNA biotechnology, plasmid inserted with a “correct" DNA sequence is transferred to bacteria for rapid.