REGULATION OF GENE EXPRESSION Gene Regulatory transcription factors can activate or inhibit transcription. The arrangements and composition of nucleosomes influence transcription. DNA methylation (usually) inhibits transcription. Transcription pre-MRNA RNA processing Alternative splicing alters exon choices. RNA editing alters the base sequence of mRNAs. MRNA Small RNAS, called miRNAs and siRNAs, silence the translation of MRNA, a process called RNA interference. Translation Proteins that bind to the 5' end of MRNA regulate translation. MRNA stability may be influenced by RNA-binding proteins. Protein Posttranslatlonal modificatlons Feedback inhibition and covalent modifications regulate protein function. Functional protein fficient?

REGULATION OF GENE EXPRESSION Gene Regulatory transcription factors can activate or inhibit transcription. The arrangements and composition of nucleosomes influence transcription. DNA methylation (usually) inhibits transcription. Transcription pre-MRNA RNA processing Alternative splicing alters exon choices. RNA editing alters the base sequence of mRNAs. MRNA Small RNAS, called miRNAs and siRNAs, silence the translation of MRNA, a process called RNA interference. Translation Proteins that bind to the 5' end of MRNA regulate translation. MRNA stability may be influenced by RNA-binding proteins. Protein Posttranslatlonal modificatlons Feedback inhibition and covalent modifications regulate protein function. Functional protein fficient?

Name: At which of these levels isregulation of gene expression most energy-e
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: At which of these levels isregulation of gene expression most energy-efficient? REGULATION OFGENE EXPRESSIONGeneRegulatory transcription factorscan activate or inhibit transcription.The arrangements and compositionof nucleosomes influence transcripti

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Similar questions

I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…
GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype
How the transcription of one gene can be regulatedby the interplay of multiple promoter and enhancer elementsand the transcription factors ?
Alternative splicing is a common mechanism for eukaryotes toexpand their repertoire of gene functions. At least one estimateindicates that approximately 50 percent of human genes usealternative splicing, and approximately 15 percent of diseasecausingmutations involve aberrant alternative splicing. Differenttissues show remarkably different frequencies of alternativesplicing, with the brain accounting for approximately 18 percentof such events. Why might some tissues engage in more alternative splicingthan others?
A single mutation in one of the transcription factors inProblem 33 results in a drastic reduction in YFG transcription. Diagram what this mutant interaction mightlook like
cerials ates During mRNA processing, certain changes are made to pre-MRNA. These changes have specific functions. Which of the following is not a function of MRNA processing? * es bers rences Repress translation. nline Help ribosomes attach for translation. la Facilitate the transport of MRNA into the cytoplasm. Protect mRNA from hydrolytic enzymes. eriods 1 and 2 ds P1, Highschool bol MP3, P4 Refer to the codon diagram on. Which of the following is a codon that will terminate translation? * hu Fri INTL O O O
Name: Clas: Date: Transcription 3" ATGACGGATCAGCCGCAAGOCGGAAfTGGCGACATAA UACUGCCUAGUCGGCGUU 3 5' WA WAW TACTGCCTAGTCGGCG TCGCCTTAACCGCTGTATT 3' 6 Label the diagram as you read the following passage. Transcription is the process cells use to copy information from DNA into messenger RNA copies. Part of the chromosome's tightly wound-up long strand of DNA is "loosened" to allow for RNA polymerase room to copy part of the DNA. Think of this as opening a page out of a giant book with thousands of pages to make a copy of just that one page. One side of the DNA strand is the template strand (or anti-sense strand) and is used by an enzyme called RNA Polymerase to create the messenger RNA. RNA Polymerase is directed by a bunch of proteins called transcription factors to the spot it needs to start copying. RNA Polymerase reads the template strand from the 3' end to the 5' end and creates a messenger RNA strand that is complementary to the template strand. In the diagram above, you can see that…
Туре of mutation: Effect: Original Altered protein/ amino acid sequence sequence DNA nucleotide MRNA AUUCGAGUA AUUCGGGUA amino acid MRNA ACGGAACCG ACGGUACCG amino acid MRNA GCUAGAAGU GCUUGAAGU amino acid MRNA GGCGCUACAUCA GGCAGCUACAUC A amino acid MRNA GGCGCUACAUCA GGGCUACAUCA amino acid
Iove aIung the HRNA from codon to codon, the appropriate amino acids are brought into place and linked together according to the sequence of codons. Thus, the code in the mRNA is translated into a special sequence of amino acids. The order of the amino acids in the protein, therefore, is specified by the MRNA, which in turn is transcribed from the DNA. Procedures and Observations: During transcription, the DNA double helix unwinds and "unzips. The two strands separate as the hydrogen bonds binding the nitrogen bases break. Then, nucleotides present in the cell line up along one strand of the DNA, the order of the nucleotides determined by the order of the nucleotides in the DNA. As the mRNA forms, uracil (U) nucleotides match with adenine (A) nucleotides; cytosine (C) nucleotides match with guanine (G) nucleotides. Note: RNA contains uracil (U) nucleotides where thymine (T) nucleotides would occur in DNA. The nucleotides in the newly formed mRNA are complementary to the nucleotides of…
How is it possible that a given mRNA in a cell is found throughoutthe cytoplasm but the protein that it encodes is only found in afew specific regions?
TAN TTGC IGGAG Nanog regulatory sequence Given this interaction map which DNA sequence would the transcription factor most likely bind to? CAAGGAG ATTAACG TAATTGG TAATTGC
For each element in the list that follows, indicate whatkind of molecule it is (DNA, RNA, protein, smallmolecule), whether it acts as a positive or negativeregulator, what stage of gene expression it affects, andwhether it acts in cis or in trans. (In its most generalsense, the term cis describes elements that affect the function of the molecule of which it is a part, whiletrans describes elements on one molecule that affectthe function of a different molecule.)a. Lac repressorb. lac operatorc. CRPd. CRP-binding sitee. Trp repressorf. charged tRNATrp (in terms of its function at thetrp operon)g. the antiterminator at the trp operonh. a terminator in the expression platform of ariboswitchi. an sRNA that blocks mRNA translation