Answered: QUESTION 10 In the following diagram,…

QUESTION 10 In the following diagram, which is the C terminus of the protein?_ - Choose from ABCD. Which is the 5' end of the MRNA? B A O A. None of these answers is correct O B. C, A O C. B, D

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Related questions

Q: Post-transcriptional control of gene regulation: None of the above Can stop gene expression quickly…

A: Proteins are a type of macromolecules that are critical for different varieties of roles in cellular…

Q: Match the term and its description. Each term can only be used once. a series of nonoverlapping,…

A: A codon is a 3 nucleotide sequence triplet unit and each codon codes for specific amino acids. the…

Q: This question refers to the MRNA sequence below: 5'-A ACGAAUAUGUUAAUCGUAGCCACCUGGUUCAGCUAAGGUGA-3'…

A: CGU is the correct answer.

Q: Which of the following is required for RNA splicing to occur?

A: RNA splicing is the process in which newly made precursor m-RNA is transferred into a mature mRNA.

Q: A ribozyme is a catalytic protein that assists in the processing of tRNA. Question 1 options:…

A: Ribozymes are defined as RNA (ribonucleic acid) enzyme that are capable of catalyzing a chemical…

Q: on The TATA box in the promoter region of prokaryotic cells helps the RNA polymerase to bind…

A: True.

Q: Question 39 The graphic below shows Taq polymerase extending the primer upon a strand of DNA. What…

A: ddNTP is dideoxy nucleotide triphosphate which are used in DNA sequencing techniques because these…

Q: Can you give further explanations regarding this topic? We are about to tackle this in our next…

A: Our DNA is made up of four bases which are A= Adenine, C= Cytosine, G= Guanine, and T= Thymine. Here…

Q: Question 4. Which enzyme is used in the processing of miRNAs that are encoded in the genome but NOT…

A: Non coding RNAs (ncRNAs) like as microRNAs and small interfering RNAs (siRNAs) play important roles…

Q: Which of the following statement about mRNA is TRUE? Question 12 options: mRNA splicing is a…

A: mRNA The mRNA or messenger ribonucleic acid is the single stranded RNA which have code for…

Q: There is a specific enzyme that adds the 5' Cap to mRNA. If an inhibitor of this enzyme were added…

A: Cap in RNA is a molecule of 7 methyl guanosine at 5' end.

Q: Question 12 Which of the following best describes the assembly process to initiate translation in…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: Question 3. An abnormally high levels intracellular tangles are observed to occur in the brains of…

A: Q3.Tangles are seen in the cytoplasm of dead and dying nerve cells. They are composed of twisted…

Q: Which of the following RNAS is the product of transcription?

A: Transcription is the process of making an RNA copy of a gene sequence

Q: Which of the following step is NOT involved in eukaryotic MRNA synthesis? O Elongation O…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: QUESTION 49 What process copies a gene into RNA form? O a. Ribosomal RNA O b. Messenger RNA O C.…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: code, indicate which polypeptides would be synthesized if poly-UGG were used in a s G

A: Poly-V indicates valine Poly-G indicates Glycine Ploy-W indicates Tryptophan Poly-Y indicates…

Q: Question 28 Introns Protein-coding sequences that need to be excised B Non-coding regions that need…

A: Introns -- Introns are described as nucleotide sequences in DNA and RNA ,do not directly code for…

Q: Which mRNA would be made if the sequence of the DNA coding strand is GAC? O GAC O GTC O GUC O CUG

A: Amino acids are organic compounds with amino and carboxyl functional groups as well as a side chain…

Q: Question 1: The c-myc gene has several exons. What are the stages of the maturation process that its…

A: Introduction - The cellular equivalent of the retroviral v-myc oncogene, the c-myc gene, was found…

Q: If an mRNA has the sequence 5'--AUGGUGUUA--3' what is the sequence of the coding DNA strand? Please…

A: To understand these concepts the Central dogma is very important, after that the pairing rule.

Q: Which mutation that would result to a change of amino acid in the polypeptide? missense mutation…

A: When a DNA gene is destroyed or mutated in such a way that the genetic message carried by that gene…

Q: In eukaryotes, translation occurs ... Question 30 options: along the cytoskeleton. in the…

A: The translation process is the part of gene expression. The gene expression involves transcription…

Q: Occurring in the nucleus ribosome mitochondrion , translation transcription is the…

A: DNA is the molecule that stores genetic information. It is present in the nucleus of the eukaryotic…

Q: 3. Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart in…

A: Question 3 A) TAC CTA GCG CAC ATG TAG GTG GGC AAA GTT m-RNA sequence: AUG GAU CGC GUG UAC AUC CAC…

Q: If a DNA strand with the sequence GGCATGCCTATGCGA is transcribed, which of the following accurately…

A: Transcription is a crucial part of the central dogma of molecular biology. It transfers the genetic…

Q: Question 8 The inflation of transcription of a given gene auteurs when RNA polymerase binds to…

A: The question asked is about the method of transcription in a gene. Transcription is a imperative…

Q: Question 6 The role of tRNA in translation is to ? A, spell out the order of amino acids in a…

A: RNA molecules come in an assortment of forms. For occasion, mRNA is made within the nucleus…

Q: Question 53 Which of the following contains the molecules that are involved in process of…

A: Gene expression is a very important process where in the information which is contained in the genes…

Q: The site on the ribosome complex which binds the new incoming amino acid- TRNA is called the A P…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
I only need letter D and E
Give the single letter translation for the protein encoded by this mRNA. Start with the start codon. 5' M7GPPP- CCGACGUAUAUGGCGACUGAUCACUGACCAACGAAAA O ATDHXPTK OPTYMATDH MRAHVT O MATDH AAAAAA - 3'
AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons b. tRAN anticodons c. amino acids
I want clear handwritten solution of all parts ...i will up vote
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
What is the lagging strand sequence if the leading strand of DNA is TTA CCG ATC GAA? How many amino acids can be identified if the coded mRNA sequence is GCAUUACAUGGCGGA
below is a prokaryotic mRNA transcript and the polypeptide that results as this transcript is translated. Pro Arg CCU CGU CAU 3 c. in the diagram translation is currently in the elongation phase d. the enzyme involved here is RNA polymerase e. codons of the mRNA reading frame are translated in the 3'5' direction in Indicate true (T) or false (F) for each statements below. Only use the letter (T/F) in the space provided a. tRNAArg is bound at the P-site b. The amino acid that will be added next to the chain is His
1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that produces the amino acid sequence shown above would be characterized as a missense mutation? Select one: O A. CUC UAG GGU GGC GUA OB. CUC UAC GGG GGC GUA OC. CUC UAC GGU GGC GCU O D. CUC UAU GGU GGC GUA
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
will give rating