Question 1. What recruits the enzymes that form the 7-methylguanosine 5' cap on the transcript as it is converted to an hnRNA/primary mRNA?

Q: Review transcription. Match the term and its description. Each term can only be used once. RNA…

A: RNa synthesis is catalyzed by the enzyme - RNA polymerase The DNA sequence where RNA polymerase…

Q: What if you designed a CRISPR/cas9 assay for a gene knockout, but there's no PAM sequence…

A:

Q: Define the transcription unit. How does it differ from the gene? Describe how you would determine…

A: Succession of nucleotides in DNA that codes for a solitary RNA particle, alongside the arrangements…

Q: Questions 19-24: Gene structure/Splicing problem. “Protein X" consists of a total of 431 amino…

A: In a DNA sequence, Intron is the non coding portion and exon is the coding portion. After splicing…

Q: Affected people are usually born to unaffected parents. Parents of affected people are usually…

A: 1. Autosomal recessive  2  X linked dominant  3. X linked recessive  4.  Y linked

Q: GQ4

A: The objective of the question is to determine the type of mutation that would occur if a specific…

Q: Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence…

A: A gene is a segment of DNA that contains the necessary information for the synthesis of a functional…

Q: Which of these statements best describes the major difference between enhancers and promoter…

A: Enhancer sections are regulator DNA regions that promote the transcription of a linked gene when…

Q: A. The single-stranded RNA would complement the target RNA. B. Gene expression is inactivated once…

A: Cell has many enzymes which help the cellular activities while other enzymes negatively regulate…

Q: Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition…

A: Given: Recognition sequence for the enzyme: 5' - GGATCC -3' - Every restriction site is a…

Q: What is the difference between an operator and a promoter?

A: Replication is the process by which DNA makes identical copies. Transcription is the formation of…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Which of the following aspects of transcription is true for bacteria but not Eukaryotes? O…

A: A cell is the basic fundamental unit of a living organism. Living organisms are divided on the basis…

Q: Question 31

A: Restriction endonucleases are the enzymes that are used to cut DNA (deoxyribonucleic acid) at the…

Q: The trpR gene encodes an allosteric protein that binds the amino acid tryptophan and regulates the…

A: Trp operon is also known as tryptophan operon. The tryptophan operon consists of structural genes,…

Q: Question 1: While examining a gene related to calcium ion channels in humans (CACNA1S) you discover…

A: D IS THE CORRECT ANSWER. AND EXPLANATION IS GIVEN BELOW .Explanation:

Q: Indicate what component (A to E) in the drawing corresponds to each of the following:   Enhancers,…

A: By means of a process called DNA transcription, RNA polymerase rewrites the genetic data present in…

Q: The lac repressor in bacteria and when lactose is present, the lac genes O Inhibits transcription of…

A: The lac repressor inhibits the transcription. In lactose metabolism, the lac operon is very much…

Q: Question 4: Explain how a deletion mutation leading to a modification of the 3' untranslated region…

A: How a deletion mutation in the 3' UTR of CACNA1S mRNA could lead to hypokalemic periodic paralysis…

Q: Questions 19-22: Based on the information presented above (and relevant info from your textbook,…

A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: How long is the polypeptide produced from the following mRNA transcript?…

A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…

Q: Question 4. Which enzyme is used in the processing of miRNAs that are encoded in the genome but NOT…

A: Non coding RNAs (ncRNAs) like as microRNAs and small interfering RNAs (siRNAs) play important roles…

Q: In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence of the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like helical structure which acts as genetic…

Q: Question 6. What are the first three amino acids in the protein that is produced from this gene?…

A: Genetic code exists in the form of codons and these codons are the sets of three nucleotides. There…

Q: A) Which of the transcription components must be present during the preincubation to keep the…

A: The term "chromatin" describes the DNA and protein mixture that makes up the chromosomes found in…

Q: Question 2. Which laboratory method can be used to quantify levels of all mRNAs expressed in samples…

A: RNA sequencing or RNA-seq is a powerful laboratory method used to quantify the expression levels of…

Q: QUESTION NUMBER: 23 Transcription of the zygote nucleus is dispensable in Drosophila early…

A: As insects are globally distributed and have ecological relevance, the ability to extrapolate…

Q: The IRNA that was in the P site moves into the A site C. The tRNA that was in the A site moves to…

A: The process of protein synthesis is called translation. In this process transfer RNA, messenger RNA…

Q: QUESTION 2 Which of the following pairs of tRNA antiqodons is most likely to be used in translation…

A: Polypeptide synthesis relies on a constant supply of tRNAs that are charged with 20 amino acids.…

Q: Question 15 When you successfully inserted a gene fragment into the Hindill site and transform…

A: Genetic engineering refers to making desired changes in the genome of the organism. Transformation…

Q: QUESTION 10 Of the proteins listed below, choose all of those that are part of the basal…

A: As per the central dogma of molecular biology, direction of flow of information is DNA RNA Protein.…

Q: 2. Justin: A CGT I I C. What is the sequence for this portion of Justin's p53 gene?

A: The Sanger sequencing use chain termination process because it use ddNTPs. When ddNTPs are…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

A:

Q: a.Explain the production of chymosin in a prokaryotic vector and the problems encountered in its…

A: Chymosin is also known as Rennin.  It is a proteolytic enzyme which is related to pepsin that…

Q: Genes in the same species that have similar related functions are: a. paralogous b. orthologous c.…

A: The fundamental structural and operational component of inheritance is a gene. DNA is the component…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: UUUUU..3' Rho-independent (intrinsic) terminators in bacterial transcripts consist of a sequence…

A: Intrinsic terminators, often referred to as rho-independent terminators, are sequence patterns…

Q: A bacterial cell undergoes a change and the two Trp codons of the tryptophan leader sequence are…

A: Tryptophan operon is an example of repressible operon which remain transcriptionally active and…

Q: Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition…

A: Restriction enzymes also called molecular scissors are originally a part of a bacterial defence…

Q: Which of the following are the enzymes involved in post-transcriptional modification?   Question…

A: The objective of the question is to identify the enzymes involved in post-transcriptional…

Q: could random or site- directed mutagenesjs

A: Mutagenesis can be defined as an important process by which the genetic information of an organism…

Q: A. The insertion shifts the reading frame to the right. The deletion frame shifts the reading frame…

A: DNA is two stranded helical structure which act as template for making of mRNA. It also functions as…

Q: Question:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to…

A: The Central dogma of molecular biology involves the synthesis of RNA using DNA as template by the…

Q: GQ3

A: The objective of the question is to determine the type of mutation that would occur if a specific…

Q: Write a short description about post transcriptional modification?

A: DNA transcription happens in the nucleus of the cells. The RNA that is produced in this process is…

Q: Question 1 of 10 Question 1. You isolate a mouse Tau-gene-containing DNA fragment from the chicken…

A: Heterogeneous nuclear RNA (hnRNA) is a pre mRNA formed after the transcription of DNA. This is…

Q: Question 1 Give a short but clear overview of the multi-level regulation of gene expression.

A: Gene regulation is fundamental for viruses, prokaryotes and eukaryotes as it builds the adaptability…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.