
Database System Concepts
7th Edition
ISBN: 9780078022159
Author: Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Python only
1. Define printGrid
Use def to define printGrid
Within the definition of printGrid, use any kind of loop in at least one place.
Within the loop within the definition of printGrid, use any kind of loop in at least one place.
it should look like this when called ;
printGrid(['abcd','efgh','ijkl'])
Prints:
a b c
d e f
g h i
j k l
2. Define getColumns
Use def to define getColumns
Within the definition of getColumns, use any kind of loop in at least one place.
Within the definition of getColumns, use return _ in at least one place.
it should look like this when called ;
getColumns(['abcd','efgh','ijkl'])
Out[]:
['aei', 'bfj', 'cgk', 'dhl']
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 3 steps with 1 images

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- In C++Using the code provided belowDo the Following: Modify the Insert Tool Function to ask the user if they want to expand the tool holder to accommodate additional tools Add the code to the insert tool function to increase the capacity of the toolbox (Dynamic Array) USE THE FOLLOWING CODE and MODIFY IT: #define _SECURE_SCL_DEPRECATE 0 #include <iostream> #include <string> #include <cstdlib> using namespace std; class GChar { public: static const int DEFAULT_CAPACITY = 5; //constructor GChar(string name = "john", int capacity = DEFAULT_CAPACITY); //copy constructor GChar(const GChar& source); //Overload Assignment GChar& operator=(const GChar& source); //Destructor ~GChar(); //Insert a New Tool void insert(const std::string& toolName); private: //data members string name; int capacity; int used; string* toolHolder; }; //constructor GChar::GChar(string n, int cap) { name = n; capacity = cap; used = 0; toolHolder = new…arrow_forwardUsing a Sentinel Value to Control a while Loop in Java Summary In this lab, you write a while loop that uses a sentinel value to control a loop in a Java program that has been provided. You also write the statements that make up the body of the loop. The source code file already contains the necessary variable declarations and output statements. Each theater patron enters a value from 0 to 4 indicating the number of stars the patron awards to the Guide’s featured movie of the week. The program executes continuously until the theater manager enters a negative number to quit. At the end of the program, you should display the average star rating for the movie. Instructions Ensure the file named MovieGuide.java is open. Write the while loop using a sentinel value to control the loop, and write the statements that make up the body of the loop to calculate the average star rating. Execute the program by clicking Run. Input the following: 0, 3, 4, 4, 1, 1, 2, -1 Check that the…arrow_forwardc++ code Screenshot and code is mustarrow_forward
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forwardComputer Science Part C: Interactive Driver Program Write an interactive driver program that creates a Course object (you can decide the name and roster/waitlist sizes). Then, use a loop to interactively allow the user to add students, drop students, or view the course. Display the result (success/failure) of each add/drop.arrow_forwardPythonarrow_forward
- LANGUAGE: C++ This is a free choice program to demonstrate a 2D array. Please don’t choose the totally obvious choices such as tic tac toe where you can obtain the code directly from online. If you were going to do tic tac toe you would have to modify the game or make it totally unique from code that is online. Preferably, I would like you to make something zany up instead, it doesn’t have to be overly difficult, it can actually be pretty basic (but not ridiculously basic). For example, The 2D array could represent a minefield and you might have a game to pick (row,col) locations to win a prize without picking one that has a mine bomb in it, or, you could have a certain number guesses to find a hidden treasure, or advance to next round, or guess the right answer or etc. You could try to solve a mental puzzle. You could be a game piece moving around on the board. You could do something requiring someone to pick out matching items in the array to win, etc. You could have two…arrow_forwardC#: Please helparrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Database System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill EducationStarting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSONDigital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSON
- C How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSONDatabase Systems: Design, Implementation, & Manag...Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage LearningProgrammable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education

Database System Concepts
Computer Science
ISBN:9780078022159
Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:McGraw-Hill Education

Starting Out with Python (4th Edition)
Computer Science
ISBN:9780134444321
Author:Tony Gaddis
Publisher:PEARSON

Digital Fundamentals (11th Edition)
Computer Science
ISBN:9780132737968
Author:Thomas L. Floyd
Publisher:PEARSON

C How to Program (8th Edition)
Computer Science
ISBN:9780133976892
Author:Paul J. Deitel, Harvey Deitel
Publisher:PEARSON

Database Systems: Design, Implementation, & Manag...
Computer Science
ISBN:9781337627900
Author:Carlos Coronel, Steven Morris
Publisher:Cengage Learning

Programmable Logic Controllers
Computer Science
ISBN:9780073373843
Author:Frank D. Petruzella
Publisher:McGraw-Hill Education