Python only 1. Define printGrid Use def to define printGrid   Use any kind of loop Within the definition of printGrid, use any kind of loop in at least one place.   Use any kind of loop Within the loop within the definition of printGrid, use any kind of loop in at least one place.   it should look like this when called ; printGrid(['abcd','efgh','ijkl']) Prints: a b c d e f g h i j k l

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…

Computer Science Part C: Interactive Driver Program Write an interactive driver program that creates a Course object (you can decide the name and roster/waitlist sizes). Then, use a loop to interactively allow the user to add students, drop students, or view the course. Display the result (success/failure) of each add/drop.

Python

LANGUAGE: C++   This is a free choice program to demonstrate a 2D array.  Please don’t choose the totally obvious choices such as tic tac toe where you can obtain the code directly from online.  If you were going to do tic tac toe you would have to modify the game or make it totally unique from code that is online.  Preferably, I would like you to make something zany up instead, it doesn’t have to be overly difficult, it can actually be pretty basic (but not ridiculously basic).   For example, The 2D array could represent a minefield and you might have a game to pick (row,col) locations to win a prize without picking one that has a mine bomb in it, or, you could have a certain number guesses to find a hidden treasure, or advance to next round, or guess the right answer or etc.  You could try to solve a mental puzzle.  You could be a game piece moving around on the board.  You could do something requiring someone to pick out matching items in the array to win, etc.  You could have two…

C#: Please help