Predict whether loss of the following E. coli genes would be lethal or not: (a) dnaB (which encodes DnaB), (b) polA (which encodes Pol I), (c) ssb, (d) recA.

After several rounds of replication, if COVID19 RNA changes from  5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’ to  5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAG …. 3’    Which of the following describes the above event?  a) an insertion mutation occurred b) a duplication mutation occurred  c) a multi-points mutation occurred  d) a point-series mutation occurred e) an inversion mutation occurred

Please answer asap

There are two broad classes of transposons. Each class is characterized by its method of "jumping" (either through an RNA intermediate or via excision and insertion) True False   Most mutations of evolutionary significance are A)induced B)spontaneous..

A 19 year old female patient is diagnosed with chronic myelogenous leukemia. Karyotype analysis shows that the leukemic cells of this patient are heterozygous for a reciprocal translocation involving chromosomes 9 and 22. However, none of the normal, nonleukemic cells of this patient contain the translocation.  a) Describe a molecular test to determine if chemotherapy given to the patient described would be completely succesful. (That is, devise a method to make sure that the patient's blood would be free of leukemic cells.) Be as specific as possible.