Position-effect variegation occurs when a ___________---rearrangement places a gene next to the heterochromaticregion near the centromere.

Q: Two examples of types of duplication errors that occur in MPI

A: Nursing documentation must be precise, thorough, and efficient. Client reports provide information…

Q: Conserved gene order can be termed asa) Orthologb) Syntenyc) Paralogd) Microarray

A: Gene is the functional unit of heredity that consists of DNA (Deoxyribonucleic acid). The DNA…

Q: Nonallelic homologous recombination between repeats in the same orientation would not produce:…

A: Introduction :- There are two types Homologous Recombination :- allelic Homologous recombination (…

Q: Why DNA melting is required in PCR? Briefly explain how PCR can be used to detect DNA mutation.

A: PCR is a method widely used to rapidly make millions to billions of copies of a specific SNA sample.…

Q: Identify the following chromosomal mutations.

A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…

Q: continuous sequence Explain the statement. of - base

A: The sequence of bases in a portion of a DNA molecule , is called gene . It carries the instructions…

Q: The telomeres of a linear chromosome are made of identical directly repeated DNA sequences. How does…

A: Telomeres:These are the special DNA caps in the eukaryotic chromosomes that prevent the loss of…

Q: • In a ______________, DNA wraps twice around a corecomposed of histones H2A, H2B, H3, and H4.…

A: Chromosomes are the structure in which genes are located. Eukaryotic chromosomes are composed of…

Q: True or False: 1. In DNAs, the amount of adenines always equal to the amount of thymine and…

A: DNA It is a nucleic acid molecule which constitutes two polynucleotide chains wound around each…

Q: Can you please check my answer and make sure it is correct.   Question: Describe the two roles…

A: Primers provide specificity for amplification of the target sequence. They are typically 18-30…

Q: A cystic-fibrosis mutation in a certain pedigree is due toa single nucleotide-pair change. This…

A: To explain: To explain about careers of cystic fibrosis and the risks of having cystic fibrosis…

Q: What do you mean by long interspersed elements (LINEs)?

A: Long Interspersed Nuclear Element abbreviated as LINEs they make up 20 percent of the human genome .…

Q: What happens when the calf liver DNA preparation is digested with EcoRI and what does this tell you…

A: Hi, Thanks For Your Question.  Answer : When DNA, In This Case Calf Liver DNA, Is Digested With…

Q: Justify why the absorption of UV light by double-stranded DNA rises when the DNA is denatured (the…

A: Hyperchromicity is the result of a molecule's increased absorbance.

Q: True or False: When transcribing the missense strand the direction of growth is towards the…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: Identical twin brothers begin life with identical genomes andepigenomes. How will this circumstance…

A: Identical twins share same genome and epigenome as they are born from same zygote, or it can be said…

Q: Karyogram and Identification of Chromosomal Aberrations   List down five human chromosomal…

A: Karyogram A diagram or photograph of the chromosomes of  cell, arranged in homologous pairs and in a…

Q: Question 50 The presence of non-Watson base pair

A: A DNA repair mechanism is a group of processes that helps to correct the faulty or damaged DNA. This…

Q: how  PEV is used  to identify heterochromatin components

A: Heterochromatin is a type of chromatin. Chromatin is a structure of DNA wrapped around histone…

Q: • Deletions remove _______________from a chromosome and causemutant phenotypes mainly through…

A: Mutation is defined as a change which occurs in the sequence of DNA molecule which is due to…

Q: True or False.  Each time the genome is replicated, half the newly synthesized DNA is stitched…

A: At the point when a cell divided, it is significant that every daughter cell gets an…

Q: The gold elements are pseudogenes. Explain how they could have arisen after gene duplication

A: The basic functional and physical unit of heredity is referred to as genes. The genes are the units…

Q: 8. 10 12 13 14 15 17 18 19 20 21 22 X X Y

A: Sex chromosome contains genes and those genes decide whether the individual will become a male or a…

Q: . The concept of (CODIS, multiplexing) involves simultaneous detection of more than one DNA marker.

A: This is called Multiplexing.

Q: A blood stain from a crime scene and blood samples from four suspects were analyzed by PCR using…

A: In Str analysis, if the gene has homozygous alleles then there would be only one peak shown in the…

Q: This is a diagram of chromosome 17. What is the cytogenetic coordinates of a gene at the indicated…

A: Here, Cytogenetic coordinate of a gene means the position of a gene on a chromosome. A chromosome…

Q: If you ran the amplicon from the previous question (so it's about 3.7k basepairs long), on a gel,…

A: Agarose gel electrophoresis is a visualization tool that separates DNA molecules, based on their…

Q: Determine which primer pair is the best choice. • Explain why the other primers are not good…

A: A brief DNA or RNA sequence serves as the template and controls the production of a complementary…

Q: True or False. Chromatin remodeling is required for both homologous recombination and non-homologous…

A: In homologous chromosomes, exchange of the chromatin material occurs between the sister chromatids…

Q: Nullisomy is a genome mutation where a pair of homologous chromosomes that would normally be present…

A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…

Q: 5'-TTAGGGAACCCTCACTGAATGAATGAATG AATGAATGAATGAATGAATGAATGAATGAATGTTTGGGCAAATAAACGCTG-3' Re-type (or…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: (Genetic Variation) Can you please provide me an example solution using this formula: (1-m)t = qt…

A: There are several factors that can alter the Hardy-Weinberg equilibrium such as migration, mutation,…

Q: THE MOLECULAR GENETICS OF CYSTIC FIBROSIS The following is the base sequence of DNA that codes for…

A: Introduction  One strand of DNA holds the information that codes for various genes. This strand is…

Q: Which of the following would be the correct Haworth projection of a-D-Talose (linear form is in the…

A: A Haworth projection is a standard manner of formulating a structural formula that uses a basic…

Q: GTT, AT,GсT стс, Ат, GCс GTT, ATт, сст стс, АТА, СGT T G C CCG CTG, ATA, AC C стт, АТА , С GT GTC,…

A: A primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. A PCR…

Q: Doctor Kryskowski: The autosomal dominant mode of inheritance and symptoms found in the patients…

A: Asked : Most feasible way to detect the given syndrome

Q: clones produced from the same organism are found to exhibit slightly different physical traits. what…

A: Cloning is defined as the process by which cells, products, or individuals having identical or…

Q: The inheritance patterns of three STR (short tandem repeats) are used to assess the paternity of a…

A: DNA analysis can be used to determine paternity in all sexually reproducing animals. Short tandem…

Q: Bating na region of noncoding DNA on chromosome 1. Would these differences be considered a mutation?…

A: Mutation is defined as the change in the nucleotide sequence. It does not matter if the change gets…

Q: Pick from the list of abnormal karyotypes and arrange the chromosomes in a karyotype. Use the "print…

A: INTRODUCTION Karyotyping is the process of paring and ordering of  all the chromosome of an…

Q: Below are 9 possible primer pairs. • Determine which primer pair is the best choice. • Explain why…

A: Primers Primers are short nucleotide sequences (18-22bp long) used to synthesise a complementary…

Q: Question 36                  Nonhomologous end-joining (NHEJ) repairs DNA lesions that affect both…

A: Nonhomologous end-joining (NHEJ) repairs DNA lesions that affect both strands Answer: TRUE…

Q: the parentheses represent choices for each blank. They are recommend to compete as..... _______…

A: Chromosomal mutation or abnormality refers to the presence of extra, missing, or irregular ratio of…

Q: Rank the following base pairs according to their stability. Rank from most to least stable. To rank…

A: DNA is a double-stranded molecule made up of two polynucleotide strands arrange in helical form. The…

Q: . A closed circular supercoiled DNA is relaxed by treatment with topoisomerase. No matter how much…

A: DNA topoisomerases are enzymes that relieve the topological strains in the DNA by creating single or…

Q: In the Ames test shown in Figure 16-17, what is the reason for adding the liver extract to each…

A: Ames test is performed to detect the ability of a chemical to cause mutation in the DNA. Histidine…

Q: Chromosomal rearrangements can be caused crossing over between repetitive (duplicated) DNA segments…

A: Genetic variation ranges from a single nucleotide which is called single nucleotide polymorphism to…

Q: It is found at a specific spot within a gene that represents a variation of that gene. * Genetics…

A: Variation of gene is directed by the information feed by th le gene. These information is in the…