Q: When human hemoglobin undergoes a mutation, the mutant protein usually does not replace all of the…
A: The cytosol of red blood cells contains the oxygen-carrying globular protein hemoglobin, which is…
Q: What is the APC payment for HCPCS code 71046? Explain.
A: APC weight =1.56 Conversion factor CF $80.79 Wage Index 0.9445
Q: Based on the principles of RP-HPLC, which sub fraction in the figure (P1 to P8) is the most polar?…
A: HPLC (High Performance Liquid Chromatography): This method is used for protein purification. Here…
Q: Genetics of the Microorganism (RABIES VIRUS) What is the overall mutation rate or general rate of…
A: *Rabies is a fatal encephalomyelitis by the virus belongs to family Rhabdoviridae and genus…
Q: What is the difference between ORF and CDS?
A: ORF (open reading frame) is the portion of a reading frame that has ability to be translated. CDS…
Q: The Covid-19 pandemic is a scalar problem. Discuss
A: Coronavirus, also referred to as corona virus, or COVID-19 is a contagious disease induced by Severe…
Q: What is Interleukin 1 (IL-1)?
A: The immune system has a vital role in protecting the body from outside pathogens (bacteria, viruses,…
Q: In references to the "alpha-globin gene locus" or "beta-globin gene locus", the term "locus" means
A: Chromosomes are condensed form of chromatin. Chromosomes consist of two chromatids which are held…
Q: Would the following alterations to Src be oncogenic? Explain. (a) The mutation of Tyr 527 to Phe.…
A: Tyrosine kinases are an important subgroup of cellular receptors that play an important role in…
Q: Which ONE of these statements is the most accurate definition of the mode of action of imatinib?…
A: Chromosomal deletion is simply deletion of the part of the chromosome. Chromosomal inversion is a…
Q: Rarely, the conjugation of Hfr and F− cells produces two Hfr cells. Explain how this event takes…
A: The conjugation is the process of transfer of DNA from one donor bacterium to a recipient bacterium.…
Q: Between Influenza and Covid-19 name one similarity of antigenic shift and one difference between the…
A: They both have similar disease presentation, that is they both cause respiratory disease.Secondly…
Q: Approximately 1 in 100 West Africans suffer from sickle-cell anemia. Given the often devastating…
A: A genetic disorder is a disease, which is caused by abnormalities in a person’s Deoxyribonucleic…
Q: Why would attaching an enediyne- containing molecule to an antibody be an attractive way to treat…
A: Enediynes are organic compounds that contain antitumor antibiotics. It contains two triple bonds and…
Q: Calculate the D70 values for these three bacterial populations
A: The decimal reduction time or the D value is the time required for a bacterial population to…
Q: Mice and humans with inactivating mutations in the gene encoding activation-induced cytidine…
A: IgM is described as a class of immunoglobulin. It displays its function by serving as the first line…
Q: What is the genus and species of your bacteria? And What led you to confirm this result and why?…
A: My bacteria is Alcaligenes faecalis : Genus of Alcaligenes faecalis :Alcaligenes Alcaligenes is a…
Q: Explain why mutations of the Arg residue in Gsα that is ADPribosylated by cholera toxin are…
A: A potential virulence factor developed by Vibrio cholerae, which is the causative factor of cholera…
Q: Nicotinamide Adenine Dinucleotide (NAD) Assay (SIGMA Kit MAK037) analysis of tissue samples…
A: NAD is a coenzyme chemically known as Nicotinamide Adenine Dinucleotide. NAD is an electron carrier…
Q: Why does an Hfr * F- mating not yield two Hfr cells?
A: Conjugation is the process of genetic material transfer between two bacterial cells through direct…
Q: What is the molecular basis for methicillin resistance in certain strains of S. aureus (MRSA)?
A: MRSA is a gram-positive bacterium that causes infections of nearly every tissue and organ system in…
Q: Is co-immunoprecipitation from cells or tissues sufficient to prove that 2 GPCRs heterodimerize?
A: Dimerization of GPCRs initiates the signaling pathway by triggering an autophosphorylation in the…
Q: Given the following complementation chart for holes in Monstera, give me the biochemical (phenotype)…
A: When the normal phenotype is restored by the complementation effect of the two mutants, then it is…
Q: RBBP6 variant 1 was found expressed throughout the cell division cycle
A: Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: Why is the biological activity of the v-Src protein so different from that of c-Src?
A: Src is also called a proto-oncogene. It is a non-receptor tyrosine kinase. It phosphorylates…
Q: Briefly explain how heme regulates the expression of globin genes in cells that synthesize…
A: Hemoglobin synthesis are global production and heme synthesis. Globin chain production occurs in the…
Q: What is Interleukin 2 (IL-2)?
A: The immune system is actively involved in preventing pathogens and other foreign particles from…
Q: Is there non-functional leukopoiesis in Leukemoid Reaction
A: Answer: Leucocytes or leukocytes are the cells found in blood which are responsible for protecting…
Q: This asymptomatic disorder, typically discovered accidentally, is caused by mutations in the SLC36A2…
A: Both the mutations are associated with Iminoglycinuria
Q: Can wearing a mask, limiting public spaces capacity, and having travel restrictions be justified…
A: Covid 19 (Coronavirus disease 2019) is an infectious viral disease caused by SARS-CoV-2 (Severe…
Q: What is the role of neuradimase in the influenza life cycle?
A: Viral neuraminidase helps in release of progeny viruses and promotes the spread of viruses to the…
Q: why does the activation of M-cdk also result in the activation of Cdc25? What is the mechanism…
A: Cell cycle checkpoints are regulatory systems present in the eukaryotic cell cycle. It guarantees…
Q: "CRISPR-Cas Is an Adaptive Immune System in Bacteria" Explain this ?
A: Bacteria is one of the common known microscopic organisms. An organism that can not be seen through…
Q: How would you have to modify the diagram of IgG to depict an IgA molecule isolated from saliva?
A: The B-cells produce five different types of immunoglobulins according to antigens responses. The…
Q: Molecular detail of D614G strain of SARS CoV-2
A: Severe acute respiratory syndrome coronavirus 2 (SARSCoV-2) is a virus that causes COVID-19…
Q: 109 108 Wild Type tlc1 107 - tlc1 rad59 106 - tlc1 rad50 rad59 - tlc1 rad51 rad59 105 • tlc1 rad50…
A: The RAD 59 is a gene present in the yeast strain Saccharomyces cerevisiae. The proteins encoded by…
Q: Resistance to many penicillins is the result of cell wall mutations in a variety of bacteria. True…
A: Antimicrobial agents include the chemical substances that are used for the removal of…
Q: How does the loss of the Adenomatous polyposis coli (APC) protein lead to the deregulation of…
A: Answer: Introduction: Familial adenomatous polyposis (FAP) is an inherited syndrome categorized by…
Q: Certain naphthalene derivatives, such as the dansyl group, exhibit a weak yellow fluorescence when…
A: Dansyl chloride is a reagent that reacts with primary amino groups in both aliphatic and aromatic…
Q: What is Interleukin 6 (IL-6)?
A: White blood cells were the first to express a type of cytokines known as interleukins (ILs). Based…
Q: To explain: Whether both v-SNARES and t- SNARES are essential for the homotypic fusion.
A: When two membranes merge that are of the same type, such as vacuole to vacuole fusion, homotypic…
Q: who can harbor/carry the covid-19?
A: Severe acute respiratory syndrome coronavirus-2 is a novel severe acute respiratory syndrome…
Q: After Griffith injected the mouse with a heat-killed S strain and the live R strain, blood from the…
A: Bacteria are microscopic single-celled prokaryotes that thrive in diverse environmental conditions.…
Q: Given what we've discussed in class, what will be most likely outcome if you conjugate an…
A: Here Organism one = Streptomycin Resistant, Ampicillin Sensitive , F-ve Organism two= Streptomycin…
Q: What is known as Src phosphorylates ZBP1 ?
A: Introduction: The localization of beta-actin messenger RNA to the sites of active actin…
Q: What is the APC payment for HCPCS code 66984? Explain.
A: APC weight 24.56 Conversion factor CF $80.79 Wage Index 0.9445
Step by step
Solved in 2 steps
- One of the causes of morbidity for the Zika Virus is Guillain-Barré Syndrome, an immune attack of nerve cells. One possible mechanism for this is the virus's interference with normal immune function. In HIV the virus uses the CD4 receptor to enter T-cells. To assess if this might be a possibility in Zika infections BLAST the CD4 Reference Sequence (NG 027688.1) against the Zika Virus (taxid:64320) choosing "blastn" under Program Selection (select all that apply): O None of the recovered sequences have identities of greater than 80%. O Multiple Zika virus isolates are observed to have E-values of less than 0.02. O High scoring BLAST hits are observed in Zika virus isolates from humans, mosquitoes, and monkeys. O The BLAST hits return a partial cds collected in Uganda in 1947 - isolate Uganda1947.explain the most likely steps of what might happen inside a MDA-MB-231 cell after it is exposed to UV light.min+ = confers resistance to minocycline cep+ = confers resistance to cephalexin van+ = confers resistance to vancomycin The following table shows the results of your experiments. Transformation of the recipient cells was conducted, using the DNA of the donor cells. You next selected for recipient cells that had undergone transformation by plating the transformed cells on media containing minocycline. This enabled you to select for min+ cells. The min+ cells were then replica plated onto media containing cephalexin or vancomycin in order to determine the antibiotic resistance phenotypes with respect to these other two antibiotics Questions a) Of the three potential orders of these genes, which orders are possible and which are impossible based on your knowledge of the relative distance? b) Finally, determine the correct order of the three genes. Please include a DIAGRAM to illustrate how you deduced the correct gene order, as well as an explanation of your reasoning.
- As everyone is aware of, suspected COVID-19 patients are being diagnosed using the Nasopharyngeal Swab Test through Reverse-Transcriptase Polymerase Chain Reaction. Explain its principle; its advantages and disadvantages.you develop the details on the stepwise design. Can a siRNA-based technology to treat COVID-19? If so, please provideWhat population is at a greater risk for contracting COVID-19 and why? (explain in one paragraph)
- In what ways can you use aseptic technique principles in your daily life to preserve a healthy lifestyle, particularly in light of the CoVID-19 pandemic? Explain in four to five sentences.For the following diseases, describe the best technique for diagnosing them. Please make sure you include how you would tell someone with the disease from someone without the disease. B. Factor V Leiden thrombophilia is caused by a point mutation at position 1691 in exon 10 of the Factor V clotting factor gene that changes an arginine into a glutamine. This change removes one of the cleavage sites for activated protein C and leads to an increased tendency to clot.A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420…
- An experiment was performed in mice. Wild-type bone marrow is used to reconstitute lethally irradiated Cr2-/- mice (wt®Cr2-/-), or vice versa (Cr2-/-®wt). As controls, Cr2-/- bone marrow is used to reconstitute Cr2-/- recipients (Cr2-/-®Cr2-/-), and wild-type bone marrow used to reconstitute wild-type recipients (wt®wt). These mice are then inoculated with the HSV-rd virus at 106 PFU, once at day 0 and then a second time at day 28, and the anti-HSV IgG responses are measured every 7 days, as shown in figure below. a) From the data shown above, on which cell type is the expression of the complement receptor most important for humoral immunity? b) For each of the cell types expressing the complement receptor encoded by Cr2, what is the explanation for their importance in humoral immunity to HSV inoculation?Yeast cells are eukaryotes, and they require a functional secretory pathway to grow and to maintain cellular organization. But surprisingly, when SRP is removed from yeast cells by deleting the relevant genes, the cells are still alive (although they grow slowly). a) How can yeast survive without SRP? Propose two alternative hypotheses. b) How might electron microscopy of normal and SRP-deficient yeast cells help you to distinguish between these two hypotheses?Regarding the production of recombinant monoclonal antibodies, it is CORRECT to state that: * (JUST ONE STATEMENT IS CORRECT) (A) Chimeric and humanized antibodies differ in relation to the percentage of sequence of the constant chain of molecules from the human genome (B) Chimeric antibodies are industrially produced by joining purified protein fragments of the Fab fraction of murine antibodies and the constant portion of human antibodies. (C) When using cells dependent on the DHF amplification system, we must use a vector containing the coding information of the light and heavy chains and another vector that contains the coding sequence of the enzyme dihydrofolate reductase (D)The industrial purification of monoclonal antibodies should preferably use an initial step based on the use of affinity columns, which will bind the antibodies by the Fc fraction (E) The use of amplification systems such as GS and DHFR has as main objective to make the production of monoclonal antibodies…