Part II. Give what is needed. |Original DNA Sequence: TACACCT T G G C G A C G A C T MRNA Sequence: | Amino Acid Sequence: Mutated DNA Sequence #1: T A C A T C T T G G C GAC GA C T What's the mRNA sequence? (Circle the change) What will be the amino acid sequence? . Will there likely be effects?. What kind of mutation is this? Mutated DNA Sequence #2: T A C G AC C T T G G C G A C G AC T What's the mRNA sequence? (Circle the change) What will be the amino acid sequence?. Will there likely be effects?. What kind of mutation is this? Mutated DNA Sequence #3: T A C A C C T T A G C GAC GA C T What's the mRNA sequence? (Circle the change). What will be the amino acid sequence?. Will there likely be effects? | What kind of mutation is this? Mutated DNA Sequence #4: T A C A C C T T G G C GACTAC T What's the mRNA sequence? (Circle the change), What will be the amino acid sequence?. Will there likely be effects? - What kind of mutation is this? Mutated DNA Sequence #5: T A C A C C T T G G G A C GAC T What will be the corresponding mRNA sequence? What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?

4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).

Pls help ASAP

I need help please