Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in length. The DNA sequence of the lilP gene is shown below. 5'-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACTAGaaatattatttaa-3′ 3'-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGATCtttataataaatt-5'
Q: 42 1 11 01 20 18 >> 000 Based on the provided karyotype, the individual is Select all that apply.…
A: A karyotype is defined as the complete set of chromosomes of an individual. This image is generally…
Q: What differences exist within keratinocytes of the superbasal epidermis between individuals of dark…
A: Introducion Skin is the most important organ of human body. Skin acts as a barrier in human body.…
Q: What is allosteric regulation? Describe HOW allosteric regulation acts like an “on/off” switch for…
A: The cell signaling is the communication between cells that requires specific signaling molecules…
Q: Membrane potential in cells is constantly fluctuating. These fluctuations are called graded…
A: Graded potentials are small fluctuations in the membrane potential that occur due to the opening or…
Q: Explain how a peptide bond is formed in translation elongation in terms of: a) Which enzyme…
A: Introduction Peptide bonds are covalent bonds that link two amino acids together to form a peptide…
Q: Table 1.5. Comparison of the responses of plant and ants to changes in the environment using…
A: Eco-physiological principles are a set of principles that explain how organisms interact with their…
Q: Describe the negative and positive impacts of affluence (high individual consumption) on the…
A: The environment refers to the physical, biological, and social conditions and factors that surround…
Q: Stetp by step for each question!
A: Introduction Phenotype refers to the observable physical or biochemical characteristics of an…
Q: Entangles fish, marine mammals, and sea birds, preventing them from feeding or causing them to…
A: Environmental problems are having a significant impact on the world's oceans and marine life. The…
Q: 1. Provide an example for each of the following types of cell to cell signaling: juxtacrine,…
A: Introduction :- Juxtacrine is a type of cell-to-cell signaling in which the signaling molecule is…
Q: 1. Read through the introductory information and use it to fill in the table below. For each blood…
A: The ABO blood group system is a classification system for blood that depends on the presence or…
Q: THIS IS A MULTIPART QUESTION, PLEASE ANSWER ALL Using the image: 1. How would you categorize this…
A: Understanding microbe dietary needs is essential for investigating their physiology and behavior. A…
Q: Where in cellular respiration does feedback inhibition occur? What would happen if this feedback…
A: Introduction Feedback inhibition is a regulatory mechanism that occurs in many metabolic pathways…
Q: ents. The plant nese two biomes. 2) The taiga is the most extensive biome, stretching west across…
A: Taiga is the cold sub arctic region where as tundra is the coldest arctic region. The taiga lies…
Q: explain the inner cells of the skeletal muscle to include: myofibrils, sarcolemma, sarcoplasm
A: Skeletal muscles consist of tissues or fibers which are attached to bones or skeletons and mainly…
Q: 1. List three categories of nongovernmental health agencies. 2. Provide at least three ideas for…
A: Introduction: Health is more than just the absence of disease or disability; it is a state of…
Q: Question 1-4 A scientist plans to study two different species of birds on the Galapagos Islands over…
A: Competition is an interaction between individuals or species in which both require a limited…
Q: What are some common pathogenicities between bacteria, fungi, and viruses? Do they have similar…
A: Bacteria, fungi, and viruses are three types of microorganisms that can cause infections in humans…
Q: Describe the general structure of all cell membranes. What are three types of lipid molecules that…
A: Cell membrane is important for maintaining the proper internal environment of the cell and for…
Q: Why is knowing the KD of a hormone / receptor complex important?
A: A receptor complex refers to a group of proteins that interact with hormones or other signaling…
Q: inflammation is really part of the body's healing process.
A: INTRODUCTION Inflammation is a natural response of the body's immune system to protect against…
Q: Why and how do the polymerase go backward from state 2 (post-translocation state) to state…
A: During replication and transcription, the polymerase enzyme moves along the DNA template to…
Q: Compare and contrast endotoxins and exotoxins and give an example of each as part of your answer
A: INTRODUCTION Endotoxins Produced by gram negative bacteria. Exotoxins Produced by both gram positive…
Q: In corn, the following genes are linked on chromosome 3: va - variable sterile v - virescent gl -…
A: We must determine the recombination frequency between the loci based on the phenotypic ratios of the…
Q: Explain how the huckleberry plant was prepared for medicinal use
A: Introduction Various types of herbs are used as medicine from ancient time. Medicinal herbs are…
Q: Compute for the appropriate amount (mL_) of the compositions of a 10 mL 2x CTAB buffer for DNA…
A: DNA extraction is a process of isolating DNA molecules from cells, tissues, or biological samples…
Q: Describe the covalent structure of an amino acid. Then describe the 4 levels of protein folding.…
A: Biomolecules or biological molecules are the molecules that make up an organism and are required for…
Q: Describe what the ‘Simple Squamous Epithelium' looks like to you
A: Introduction : Every cell in our body is capable of carrying out a certain function. A tissue is a…
Q: O gure 1. Microbial colonies when plate was exposed from air inside the laboratory and incubated for…
A: Microbes are diverse organisms with unique capabilities and features. Most microbes are single…
Q: could be used to determine human blood group type. Glycoproteins Lipoprotein Lipopolysaccharides…
A: Blood group refers to the classification of blood based on the presence or absence of certain…
Q: What therapeutic benefits, if any, have been proposed for the psychedelic hallucinogens?
A: Psychedelic hallucinogens have been a topic of interest and controversy for many decades. These…
Q: Compare and Contrast: Surface to diving heart in turtle. Surface to diving heart in crocodile.…
A: This question compares and contrasts the adaptations of the cardiovascular systems of turtles and…
Q: What are the advantages and disadvantages of culture-dependent and culture-independent methods in…
A: Microorganisms are studied using two approaches in microbiology: culture dependent methods and…
Q: Look at the flow cytometry dot plot below and answer the questions SSC-A 250K 200K 150K 100K 50K 0…
A: Fluorescent dyes can be used to detect and monitor pollutants in the environment. Fluorescent dyes,…
Q: For a CFSTR with cell input what should be true compared to a CFSTR without cell input all else…
A: Introduction :- CFSTR stands for Continuous-Flow Stirred Tank Reactor. It is a type of chemical…
Q: The following describes which helminthic parasite? Eggs shed in feces, embryonate in warm, moist…
A: Ans) The description provided corresponds to the lifecycle of Ancylostoma (Hookworm).
Q: a) What is the most likely diagnosis and also the underlying cause of the disorder? Explain your…
A: We are given a case in which patient is receiving medication for high blood pressure. The blood…
Q: Define the following term (in relation to enzymes) Products?
A: An enzyme is a type of protein that acts as a biological catalyst, meaning it speeds up chemical…
Q: What are the huckleberry effects on biodiversity?
A: An ecosystem is a geographical region where plants, animals, and other species, as well as weather…
Q: If the membrane permeability for Na+ were suddenly increased in an excitable cell: (select all that…
A: When the membrane permeability for Na+ is increased, Na+ ions will diffuse into the cell more…
Q: Using this dehydration method, any error less than 10% is acceptable. A. If your percent error is…
A: Dehydration method refers to a process of removing water or moisture from a substance, typically a…
Q: Are there any long-term physical, neurological, or psychlogical consequences of the psychedelics?
A: Psychedelics have been used for ages to alter people's minds. While these medications have showed…
Q: Stratified squamous epithelium can be found lining the esophagus and the vagina. - In what…
A: Simple squamous epithelium and stratified squamous epithelium differ in their appearance under a…
Q: Describe the use of anaerobic digesters for producing methane. Define bioremediation. Describe two…
A: As per bartleby guidelines only 3 subparts can be answered. Please post remaining questions…
Q: Please help me with this question. How many amino acid residues are in the heavy and light chains…
A: In this answer, I provide information about the number of amino acid residues in the heavy and light…
Q: Describe the general structure of all cell membranes. How does this membrane structure determine the…
A: Introduction The cell membrane, also known as the plasma membrane, is a thin, semi-permeable…
Q: Describe how epidemiologists might determine where an outbreak occurred. List at least two federal…
A: ANSWER TO how epidemiologists might determine where an outbreak occurred. Epidemiologists utilise a…
Q: understanding Biomolecules for development of biosensors and their application, how this will…
A: Biomolecules: Biomolecules are molecules that are essential for life and are found in all living…
Q: The three beetle species live in the same ecosystem, and they likely evolved from the ancestral…
A: Introduction: The process of speciation is how one species eventually divides into two or more…
Q: In the isolation of DNA, what is the role of chloroform? choose the best asnswer -Precipitate rna…
A: DNA extraction is the process of isolating DNA from the cells of an organism isolated from a sample,…
Step by step
Solved in 4 steps with 1 images
- The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’ Answer the following questions: Q1. Which is the coding strand? Which is the template strand? [10%] Top-bottom. Bottom-Top. Both can be used as either coding or template for this gene.The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AAThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
- Based on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…Figure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at position 77. 45 5' TTGGT CTTGG TCGGA TTCCA GAGGA TGAAG TGTTG ACAGC GCATT 3' 3 AACCA GAACC AGCCT AAGGT CTCCT ACTTC ACAAC TGTCG CGTAA 5' 46 5 AATTG ACCTT GCTGT ATTAT AGCCA AGGAC AGATC TACGA GCATG 3' 3 TTAAC TGGAA CGACA TAATA TCGGT TCCTG TCTAG ATGCT CGTAC 5' 91 5 TGCGA ACCGC AAGCA TTCGT TCTCC TAGGC TACTC GATCC CGTAA 3' 3 ACGCT TGGCG TTCGT AACCA AGAGG ATCCG ATGAG CTAGG GCATT 5 77 90 110 135 136 5 TGATG TAGCT GATTC TGTTG AAAGG CTCCT TTTGG AGCCT TTTTT 3 3' ACTAC ATCGA CTAAG ACAAC TTTCC GAGGA AAACC TCGGA AAAAA 5 156 180 Figure 1. Illustrate how termination of transcription occurs in the gene above. (Hint: position from 156 to 180)
- Transcribe the following DNA sequence into RNA, and then into amino acids 5’-GTATACTTGTGGGCCAGGGCATTAGCCACACCAGCCACCACTTTCGGATCGGCAGCC-3’ 3’-CATATGAACACCCGGTCCCGTAATCGGTGTGGTCGGTGGTGAAAGCCTAGCCGTCGG-5’What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'what is the anticodon sequence that would build this protein? AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGUUGUAUUUGGUUUGUGGCGAGCGCUUUUACCAGUUAGAGAAUUACUGA
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 1317) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 80What’s the resulting amino acid sequence? 3’CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5’