No. of nucleotide found in DNA segment if it contains 100 Adenine and 100 cytosines, (a) 100 (b) 200 (c) 400 O (d) 50

Q: Define nucleosides.

A: To answer this question we should have knowledge of Biochemistry.

Q: In a nucleosome, the DNA is wrapped around(A) histones.(B) ribosomes.(C) polymerase molecules.(D) a…

A: The chromosomes are tightly packed bundles of chromatin. The chromatin consists of nucleosomes…

Q: Describe (in detail and using terminology from the course) the structure of a DNA molecule,…

A: *DNA is a double stranded molecule. DNA is a double helix, right handed.  *Both the strands of DNA…

Q: Suppose your protein purification did not work and your sample contains many different proteins.…

A: If the protein sample is not purified and the sample still contains many proteins, there would be…

Q: (d) Derive Michaelis-Menten equation of enzymatic reaction.

A: Michaelis Menten equation shows the relationship between the concentration of the substrate and…

Q: A) What is the difference between a nucleoside and a nucleotide? B) Give any two differences between…

A: DNA as well as RNA are two crucial building blocks of life. The human cells also comprises of RNA…

Q: Of what substances is the nucleolus made? Is there a membrane around the nucleolus?

A: The nucleolus is a small structure present in the nucleus of a cell and has some important…

Q: Distinguish between DNA and RNA on the basis of following:  a) chemically  b) functionally  c) by…

A: DNA and RNA are nucleic acids found in all living organisms. DNA is the short form of…

Q: b. In superhelical proteins, such as collagen, several polypeptide helices are intertwined. What is…

A: Introduction  Protein is the key biomolecule in the biological system, any important physiological…

Q: A......of a DNA consists of a sugar, a phosphate, and a nitrogen containing base. A....... is a…

A: DNA stands for Deoxyribonucleic acid. It is the genetic material in humans.

Q: If a piece of DNA contains 22% adenine (A), what percentage will be cytosine (C)? 28% 44% 22%…

A: According to the Chargaff' rule, the amount of Adenines is equal to Thymine and the amount of…

Q: A human chromosome (During Mitosis) is 4 µm long but contains 16 mm of DNA. What is the packing…

A: There are a few important points. DNA will exist in a nucleoprotein complex known as chromatin. A…

Q: If there is no helix unwinding proteins and destabilizing proteins present, what would happen?

A: Helix unwinding is the major step for DNA replication . After this step the DNA priming step occur ,…

Q: Identify the subunits of DNA and how they differ

A: Deoxyribonucleic acid is a particle made out of two polynucleotide chains that loop around one…

Q: 4 bases that make up DNA

A: A base pair consists of two complementary DNA nucleotide bases that pair together to form a rung of…

Q: What is meant by the statement “DNA strands areantiparallel”?

A: DNA is composed of two polynucleotide chains that coil and form a double helix. It consists of…

Q: What is exact location of centrosome?

A: A centrosome is a cellular organelle found only in animal cells. It serves as the major…

Q: what are centrioles?

A: Centrioles are found in most of the eukaryotic  cells.  Centrioles are surrounded by pericentriolar…

Q: (9 Why does DNA contain thymine instead of uracil? Justify.

A: Given: DNA contain Thymine instead of Uracil. DNA is a long polymer of polynucleotide chain. It…

Q: DNA strand lying alo

A: A nitrogenous base is a type of molecule that consists of nitrogen and has a base with certain…

Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…

A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…

Q: what is centrosome?

A: Centrosome is an organelle found in eukryotes mainly animal cells, fungi, and algae but absent in…

Q: explain this figure

A: Amino acids are organic molecules that contain a basic amine group (-NH2) and a carboxyl group…

Q: Some proteins are shuttled back and forth between the nucleus and the cytoplasm.  How do you think…

A: Nuclear envelop found in the cells, separates the contents of nucleus from cytoplasm and also…

Q: If the G+C content of a sample of DNA is 46%, what are the proportions of all four nucleotides?

A: Nucleotides are molecules that consist of phosphate and nucleoside. These serve as monomeric units…

Q: Carbohydrates and proteins participate in hydrolysis reactions during the formation of…

A: Carbohydrates and protein are biomolecules. Both of these are macromolecules. Carbohydrates and…

Q: Define beta (b) sheet

A: Proteins have different organization levels, which gives the properly folded functional form of the…

Q: What is centriole ?

A: Centrioles are paired barrel-shaped organelles located in the cytoplasm of the animal cells near the…

Q: Which conformation of DNA – (i) totally double helix, (ii) minimally unwound or (iii) largely…

A: Just as a high temperature can denature protein, nucleic acids such as DNA and RNA can too be…

Q: Hydrogen bonds are important in DNA replication and transcription.  They are relatively weak…

A: Hydrogen bonds are a type of attractive interaction between an electronegative atom and a hydrogen…

Q: Define cytotoxic nucleotide.

A: Introduction  DNA strand is composed of three components: Deoxyribose Sugar Nitrogenous Bases…

Q: You are performing an enzymatic reaction to digest DNA and nothing is working. The working solution…

A: Ans: There are range of restriction enzymes isolated from various bacterial species which are…

Q: Why can't we store Vitamin C in our bodies?

A: Vitamin C- Ascorbic acid It is vital for tissue repair, and collagen synthesis, and its deficiency-…

Q: Give the specific function of centrosome.

A: A well-known regulator of the cell cycle of the animal cell that is known to microtubule organizing…

Q: Which of the following statements is (are) true? (a) The two strands of DNA run parallel from their…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: 1. a) What does DNA stand for? b)What is the name of the DNA structure?

A: DNA is self replicating by molecules that are present in chromosome and carry in genetic…

Q: HO-P-O- Ο о NH2 OH OH N O HO-P-O-P O-P O Ο Ο OH NH2 Which statement is true about the nucleic acid…

A: To determine the correct statement, we need to correctly identify the given molecules and their…

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…