Name and briefly describe three major contributions that Dr. DeBakey made to medicine and biomedical research (minimum 60 words)

Q: Part 4: Peppered Moth Allele and Gene Frequencies The dark allele in peppered moths is dominant (B=…

A: According to Hardy Weinberg equation p2 + q2 + 2pq =1 and p + q = 1 p = frequency of the dominant…

Q: When introducing solid foods, infants experience food allergies that eventually weaken over time…

A: From birth until age one, infants are regarded as children. Any kid between the ages of birth and…

Q: 4. T/F about BOD ● A measure of dissolved oxygen in 5 days at 20 deg Measure of organic matter in…

A: Introduction  Biological Oxygen Demand (BOD) is a measure of the amount of oxygen that is consumed…

Q: Muscular Dystrophy is an X linked recessive disease. Maria and Nick are getting genetic counseling…

A: Answer : Given that, Muscular Dystrophy is an X linked recessive disease, this means the disease…

Q: Q- After placing fruit-fly traps that humanely kill fruit flies around the building, the population…

A: Introduction :- Evolutionary mechanisms are the processes that drive evolution, leading to changes…

Q: Yellow guinea pigs crossed with white ones always produce cream-colored offspring. Two cream guinea…

A: Given that Yellow guinea pig was crossed with white one.  Thus cross will always produce cream…

Q: What is the name of both the male and female part of a flowering plant?

A: A flowering plant is a type of plant that produces flowers for reproduction. These plants are also…

Q: Appearance Morphology Arrangement Stain Used Magnification Staphylococcus Escherichia epidermidis…

A: In the list there are different bacteria present. These are either gram positive or Gram Negative…

Q: For the following genotypes state the ABO blood phenotype.   IAIA  -   IBIO -   IOIO -   IAIB…

A: In genetics, the genotype is an organism's entire inherited genetic makeup, whereas the phenotype is…

Q: Regarding the Global Reporting Initiative (GRI) GRI-G4 Guidelines, what are the indicators related…

A: Introduction  Health is a state of complete physical, mental, and social well-being and not merely…

Q: Alleles that are masked by an epistatic locus are said to be hypostatic to the genes at that locus.…

A: Introduction - Epistatic Gene Interaction- Epistasis describes the situation in which a gene masks…

Q: The function of Periosteum

A: Introduction :- The periosteum is a double-layered membrane that covers most bones in the body. The…

Q: Differentiate between bacterial infectionand bacterial intoxication.        Discuss the…

A: Bacteria are the prokaryogic microorganisms that infect the living beings. They can easily multiply…

Q: The function of Nutrient artery

A: Introduction  Nutrition is the process by which the body obtains and utilizes nutrients from food in…

Q: Predict how mutations in the gene that encodes the spike protein might affect the types of cells the…

A: Introduction :- The spike protein is a component of many different types of viruses, including…

Q: Some athletes have drink beet juice (yes, juice from beets) to improve their endurance performance.…

A: The red beet route is considered as the nutrient power house as it consists of antioxidants such as…

Q: Pigeon color coat is determined by one autosomal gene with two alleles Y and y. Where Y is blue…

A: Introduction  Alleles are different versions of the same gene. Each gene typically has two alleles,…

Q: Mass spectrometry and X‑ray diffraction are common biochemical techniques for characterizing…

A: In order to determine the mass-to-charge ratio (m/z) of one or more molecules found in a sample,…

Q: Considering that in aerobic respiration 38 atp is created and in anaerobic respiration 2 are created…

A: When it comes to metabolism, aerobic respiration and anaerobic respiration are two of the most…

Q: What is the difference between aerobic and anaerobic respiration?

A: Aerobic respiration requires oxygen and produces more ATP (energy) per molecule of glucose than…

Q: Why does Complex II use FAD instead of NAD+ as its electron acceptor?

A: Cellular respiration is a metabolic phenomenon in which glucose molecule is degraded and results in…

Q: What is epigeneitcs and what role can it play in human disease?

A: Epigenetics is the study of changes in gene expression or cellular phenotype that do not involve…

Q: How does annealing ensure that a specific sequence of DNA will be amplified in the PCR (rather than…

A: Polymerase chain reaction (PCR) is an effective method for amplifying particular DNA sequences, and…

Q: Provide the sequences of the template and coding strands of a DNA double helix that was used to…

A: Introduction :- The template strand is a strand of DNA that serves as the blueprint for the…

Q: Describe the 4 different types of human cells.  How are their sizes and shapes the same?  How are…

A: Introduction  A cell is the basic unit of life and the smallest structure capable of performing all…

Q: 1. If a single transition occurs in a codon that specifies Phe. List all the possible mutated codons…

A: Transition Mutation: In genetics and molecular biology, the term "transition" refers to a point…

Q: Renal failure will almost always result in the development of bone disorders. Briefly describe the…

A: Introduction :  Renal Osteodystrophy is the term used to describe the overall skeleton abnormalities…

Q: Explain well the principle behind the streak plate method.

A: In microbiology, there are two types of cultures, pure culture and mixed culture. In pure culture,…

Q: How will you prepare a good fecal smear for microscopic examination?

A: A stool sample is tested in a lab using a faecal smear. The purpose of this test is to look for…

Q: What is the mrna codon that corresponds with binds to the anticodon of this trna molecule ccg ggc…

A: Codons and anticodons are sequences of nitrogenous bases in RNA molecules that play a crucial role…

Q: Rotate Eyepiece Y-Axis X-Axis The stage micrometer has been recalibrated with a different objective…

A: Estimation of a size by objective lens can be done by counting the number of divisions add the…

Q: How many different enzymatic activities are required in human cells to repair the most common damage…

A: Introduction - five major repair pathway- 1—base excision repair (BER) 2. nucleotide excision repair…

Q: A class of students mated fruit flies to study the inheritance of traits. The crosses and their…

A: Introduction :  A single cell divides twice to form four cells during the meiosis process. The…

Q: The adrenal medulla secretes: a) more norepinephrine than epinephrine b) only epinephrine c) more…

A: Introduction :- The adrenal medulla is part of the adrenal glands, which are located near the…

Q: In the year 2500, five male space colonists and five female space colonists (all unrelated to each…

A: Introduction According to the Hardy - Weinberg equilibrium the allele frequencies of a population…

Q: What factors or conditions other than temperature may alter the rate of metabolism?

A: Metabolism refers to the chemical processes that occur within living organisms to maintain life. It…

Q: man and a woman have a child. The father is blood type A, and one of his parents was blood type A…

A: H antigen is referred to as Bombay antigen. Presence of dominant H antigen either in homozygous ( HH…

Q: Having dimples (D) is dominant over not having dimples (d). A dimpled woman (whose father had no…

A: Answer :  Given that, A dimpled woman marries a man whose mother had no dimples, whose father had no…

Q: 2. A polypeptide for a gene has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The…

A: A mutation is a permanent change in the DNA sequence that makes up a gene. Mutations can have a…

Q: Which one of the following traits is not shared by most model species? A. High fecundity B. Short…

A: Introduction  Development refers to the process by which a living organism grows and changes over…

Q: TRUE OR FALSE 1. Cancer cell lines may come from transformed cell lines. 2. Transgenic rats are rats…

A: The uncontrolled division of cancer cells can result in solid tumours or an overabundance of…

Q: What are steroids? Give examples of steroids What are waxes? What are the subunit / monomer of…

A: Biomolecules:  An organism's molecules that are necessary for one or more usually biological…

Q: Because stimulation and experience are key in strong brain development, infancy is often referred to…

A: Introduction :- Infancy is the earliest stage of childhood, typically defined as the first year of…

Q: Analyse the role of antagonist, agonist and synergist muscle and their contractions.

A: Introduction :- Muscles are a type of soft tissue in the body that are responsible for movement and…

Q: Explain how sex and separately how age can affect the number of mutations in sex cells.

A: In humans and other animals, the cells that produce sex cells called germ cells, divide multiple…

Q: one too few females one too many somatic cells infertility the germ line less sex chromosomes males…

A: Introduction : Aneuploidy refers to a condition in which an individual has an abnormal number of…

Q: What is a bacteroid? What features differentiate it from a bacterium?

A: A microorganism is a microscopic organism, typically too small to be seen with the naked eye. They…

Q: GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA…

A: m RNA sequence is created by the enzyme called RNA polymerase that copies the nucleotides according…

Q: 5. Are coding regions of DNA more affected by drift or selection? What about non-coding regions? Why…

A: Genetic drift and natural selection are two processes that shape the evolution of species.   Genetic…

Q: 8. Which method can separate different cell structures from each other in a biology lab? A)…

A: Introduction  Cell structures are the different components that make up a cell. Cells are the basic…