Which of the following traits would you expect to be under weakest selection? Explain your answer. The development of prostate cancer in older male humans The development of digits in frogs The silver hair color on silver back male gorillas The dance choreography in peacock spiders

Which of the following traits would you expect to be under weakest selection? Explain your answer. The development of prostate cancer in older male humans The development of digits in frogs The silver hair color on silver back male gorillas The dance choreography in peacock spiders

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter7: Development And Sex Determination

Section: Chapter Questions

Problem 9QP

See similar textbooks

Related questions

Q: In which of the following situations would you expect to probably see differences in the speed of…

A: ANSWER:- Comparison of nuclear and mitochondrial genes in the same species

Q: If an embryo was lacking HOX genes many problems might happen including this.. neural crest would…

A: The Hox genes' function in the embryo is to specify positional uniqueness instead of the formation…

Q: osteopathy and chiropractic

A: Osteopathy: The treatment of medical disorders by manipulating and massaging the skeleton and…

Q: if you had penicillin leftover from a previous sore throat can you use it for a leg cut. explain…

A: Kids or adults who are allergic to penicillin may be able to take one of these antibiotic instead…

Q: Female Drosophila with cinnabar eye (cn) and vestigial wings (vg) were mated to males with roof…

A: Answer given in step 2 onwards. As per our guideline i can answer only 3 subpart only but I gave you…

Q: First food chain Second food chain Trophic level Organism Trophic level Organism

A: First food chain Trophic level organism Level 1 (Producer) Diatoms and other phytoplankton.…

Q: Barr bodies inactivate Xic on autosomes. O are formed in female somatic cells O are formed in female…

A: Barr bodies is an inactivated X-chromosome. It is present in a cell that contains more than one…

Q: What does the negative of the Methyl Red for the Enterobacter aerogenes to do

A: The methyl red (MR) test identifies the formation of enough acid during glucose fermentation and the…

Q: NSWER THIS; Click Edit DNA and make a substitution mutation that changes the first base (C) in the…

A: The genome of a cell carries various genes that code for one or more proteins. The genes are coded…

Q: 24. The most destructive practice of harvesting wood products, which cuts down all of the trees in a…

A: Clear-cutting is a silvicultural system that removes an entire stand of trees from an area of 1 ha…

Q: In a canine expt, a dog’s filtered load of sodium (Na+) in an isolated pump-perfused kidney is found…

A: Given: Filtered sodium Na+=15 mmol/min To find: To find the volume of Na+ that remains in the tubule…

Q: 0.0 1.0 0.0 3 0.0 0.0 1.0 4 0.5 0.25 0.25 5 0.25 0.25 0.5 0.25 0.5 0.25 7 0.33 0.33 0.33 8 0.04 0.32…

A: According to Hardy Weinberg equilibrium- p2+q2+2pq=1 Where, p= frequency of the dominant allele in…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A: DNA contains the genetic information about the characteristics features of te organism present in…

Q: B. Describe the following common patterns of inheritance in humans and give two human disorders for…

A: Understanding disease transmission patterns requires an understanding of basic inheritance laws.…

Q: 5. Which of the following can increase mean arterial pressure (MAP) in an individual? I. II. III.…

A: Given : Mean arterial pressure (MAP) is defined as the average arterial pressure that happens…

Q: To determine: How chloroplasts generate a larger proton gradient across the thylakoid membrane than…

A: The photochemical and electron transport reactions of photosynthesis process occur at the thylakoid…

Q: Describe one function, brought about by the process of meisos, that spermatogenisis and oogenisis…

A: Common function between spermatogenesis, oogenesis and meiosis :-

Q: how an angiotensin converting enzyme inhibitor ACE such as captopril would effective as an…

A: Anti hypertensive means the drug causes the reduction in blood pressure. Normal blood pressure is…

Q: Calcitonin is enzyme that functions to reduce blood calcium levels True O False CK may be derived…

A: Storage lipids, also known as triacylglycerols, membrane lipids, which include glycerophospholipids…

Q: Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can…

A: Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can…

Q: Exercise immediately increases end-diastolic volume.true/false

A: 1. It is true statement. End diastolic volume can be defined as the volume of blood present in the…

Q: 417 ash Course Biology #7 - ATP & Respiration 1. Cellular respiration is how we derive energy from…

A: Respiration is the biochemical process in which the cells of an organism obtain energy by combining…

Q: What are some theories or causes of narcolepsy along with the the treatment or therapeutic methods…

A: Narcolepsy is derived from the greek words "narco," that means numbness, or stiffness, and "lepsy,"…

Q: Distinguish between What is known of CD105 (endoglin) as an hepatcellular carcinoma marker and it’s…

A: There are few points that should kept in mind : A molecular or DNA marker is defined as a…

Q: The ability to taste the compound PTC is controlled by a dominant allele T, while individuals…

A: Polythiocarbamide ( PTC ) is bitter chemical compound . Sone individual able to taste it while other…

Q: what are the differences between the three-domain and five-kingdom schemes of biological…

A: The Linnaean system (1758) classified all macroscopic living organisms as either Animals or Plants,…

Q: 4. WATER HAS THE PROPERTY OF ADHESION, WHICH ALLOWS IT TO USE WHICH PROCESS IN PLANT ROOTS? A:…

A: Ans is.. capillary action

Q: ACP is specific of the pancreatitis O True O False is defect inglucuronyl transferase O Gilbert…

A: Acute pancreatitis is a pancreatic inflammatory illness that can occur all at once or in relapses.…

Q: GENERAL BIOLOGY 2 Q1 : How can plants reproduce naturally?? A. Using anthers B. Using cuttings C.…

A: plants reproduce naturally by Using runners.…

Q: What is Enterobacter aerogenes? What did Enterobacter aerogenes cause? How do you know that organism…

A: There are wide diversity of microbes present in our surrounding;like virus; bacteria;fungi etc which…

Q: a catabolic process.

Q: Frank uses improper body position to lift a heavy box and strains the muscles in his lumbar region.…

A: Muscle tissue is made up of cells that contract when they are stimulated. When the muscle cells are…

Q: To determine: How chloroplasts generate a larger proton gradient across the thylakoid membrane than…

A: For living functions, that is when it comes on to the term that the cell eukaryotic cells require a…

Q: The Human Papilloma Virus is associated with cervical cancer because it is found only in womor

A: Human papillomavirus The human papillomavirus or HPV is a sexually transmitted infection(STI). The…

Q: Which of the following would apply to desmosomes that are found in cells as they migrate from the…

A: The stratum corneum is the outermost layer of the epidermis and it marks the final stage of the…

Q: Question 19 Based on the hydropathic index plot below, where in the 3D structure of the protein…

A: To study hydropathy index, we should first note down the following points: Integral proteins are…

Q: what are 4 mutualistic interaction between two or more species that are exploited to improve…

A: Mutualism is an ecological interaction between two or more species in which each species benefits in…

Q: Based on the past activities about constructing of phylogenetic trees, how do you distinguish…

A: When the evolution of different organisms or species from a common ancestor is depicted through a…

Q: Identify the different components of the mammalian (human) blood, describe each and give their…

A: The circulatory system is a system that contains the heart, blood vessels, and blood, and blood is…

Q: 1. Explain the role of Statistics in biological science.

A: Statistics is the science of collecting, analyzing, presenting, and interpreting data.

Q: You measure the effects of a single allele (Y) on fitness in two populations of spiders, Population…

A: Introduction The incidence of a gene variant in a population is represented by the allele frequency.…

Q: Trace the pathway of sperm cells from production to release from the penis: epididymis → urethra →…

A: The sperm is produced by the spermatogenesis process within the primary sex organ of males. The…

Q: 2. Why do we use samples in the collection of data?

A: Introduction Scientific data:- It is defined as information collected using particular methods for a…

Q: Choose which does NOT belong to the group then give the commonality of the remaining 3 terms 1.…

A: (According to Bartleby guidelines, first three sub parts have been answered. Please post the…

Q: 10. Phagocytosis by a phagocyte is required for: B cell action b. helper T (T4) cell action c.…

A: Answer

Q: Assume for a moment that crossing-over did not occur. Would you agree that you received half of your…

A: Crossing over is a phenomenon that develops in novel gene combinations by transferring and swapping…

Q: To examine: whether the statement "protein tyrosine phosphatases display exquisite specificity for…

A: Protein phosphatases are the enzymes which are involved in controlling diverse array of processes in…

Q: In horses, black color (B), dominates chestnut (b). The trotting gait (T) dominates the pacing gate…

A: Phenotype of the parents - (i) black and pacing gait; (ii) chesnut and trotting gait. Genotype of…

Q: Can you explain the answer and how to find it ? Number 1

A: Any Change in the genetic material, which is not caused by recombination, tnat leads to altered…

Q: 1. What is the source of maltose? a. Small intestine brush border (microvilli) b. Pancreas c.…

A: Maltose is the disaccharides carbohydrate which is digested by the maltases Secreted by the…

Concept explainers

Primate evolution

Primates are a relatively new species and first appeared in the fossil record nearly 55 million years ago. They may have originated as far back as the cretaceous period. Their fossils were observed in North America, Asia, and Europe. Long before the first monkeys and their prosimian relatives developed, most animal species thrived and died. The first primates did not exist until about 50-55 million years ago, even though the planet is 4.54 billion years old and the first life goes back at least 3.5 billion years. Dinosaurs had been extinct for 10 to 15 million years when this happened.

Question

Which of the following traits would you expect to be under weakest selection? Explain your answer.

The development of prostate cancer in older male humans
The development of digits in frogs
The silver hair color on silver back male gorillas
The dance choreography in peacock spiders

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

we discuss various mechanisms of sex determination, including the XX/XY system of placental mammals, and the ZZ/ZW system of birds. Monotremes, the most primitive mammals, have a very intriguing sex determination scheme that shares elements of both of these systems. Please use the internet to learn more about how sex in monotremes is determined. Then write a short essay (300-400 words) describing this system and comparing/contrasting it to the XX/XY and ZZ/ZW systems.
Hello! The following butterflies are the same species, but each looks a little different. Draw or circle the butterfly that will most likely survive to pass those traits to its offspring. Explain your answer choice. Write your response 1-2 sentences long. (Picture below)
Humans have been affected by genes and the environment, including the cultural environment. True False The secular trend in puberty has resulted in a decrease in the age of menarche in human females. True False According to “The Story of Race”, what did the eugenics movement in the U.S. seek to prove? That all men and women were biologically equal. That systematic discrimination against immigrants was unacceptable. That the racial superiority argument put forth by Nazi Germany was immoral and incorrect. That lower intelligence and criminal behavior were genetically based traits of the lesser races.
Hello, please answer the following Biology question correctly based on the given answer choices. Please pick the correct "answer-letter" and explain your answer. Thank you. Biology Question: "In humans, widow's peak is dominant to a straight hairline, and free earlobes are dominant to attached earlobes. A couple who is heterozygous for both traits has kids. What is the probability that the first child will have a widow's peak hairline and attached earlobes?" Answer Choice Options: A - 1/16 B - 9/16 C - 1/4 D - 3/16
Which of the following statements regarding X inactivation in eutherian mammals is FALSE? X inactivation may occasionally occur in males (tried this answer but marked wrong) This process produces a uniform phenotype in heterozygous females The process appears to be random X inactivation occurs early in embryonic development
Normal text BIUA Arial 14 E I 1 | I 11 3 Now, let's examine a couple more examples of phenotypic plasticity. 3. Example 2: The American Peppered Moth caterpillars (Biston betularia cognataria) are able to change their color based on the color of the twigs in which they live. What advantage might this provide to these caterpillars? Biston betularia caterpillars on birch (left) and willow (right). Support Schoology Blog I PRIVACY POLICY Terms of Use !!!
What describes the phenotypic plasticity of an organism best? O the degree of which individuals can change over time by altering their genotype O the effect of variable environment on the genotype of an organism O the variation of the target phenotype for a given genotype in different environments O the change of a phenotype due to ingestion of detrimental plastic material (as for instance plastic straws by sea turtles). O the degree of which a given genotype is adapted to a particular environment
The pads on cats' feet are either made of rubber (R) or metal (r). R is dominant. Their whiskers can either form a mustache (M) or beard (m). M is dominant. Cat RrMm mates with cat Rrmm (note that the parents' genotypes are NOT identical), and they have kittens: What fraction do you "еxpect?" What # of Here is what you kittens do you "expect?"* "observe." Rubber feet/mustache Rubber feet/beard Metal feet/mustache Metal feet/ beard * Hint: The number you expect is based on how many total kittens there were; you'll have to add up all the actual 14 15 10 kittens in the next column yourself because I didn't do it for you. a) Fill out the blank columns b) What is the Chi Square formula? (for partial credit in case you miss the answer for part d). c) how many degrees of freedom in this case? (5) Perform a Chi-square test on these data, to see if there is likelihood that the R and M genes are linked. What is your resulting Chi? number? (SHOW WORK, of course) d) (3) Using the table below, what…
What are some examplesof phenotypical characteristicsthat present two or morevarieties and of phenotypicalfeatures that do not vary? Inrelation to the genescorrespondent to thosecharacteristics that varyamong individuals what canbe expected about theiralleles?
Organizations that aim to protect the rights of animals have been battling leisure breeders to stop selective breeding because they view it as a form of abuse or cruelty to animals. Selective breeding or artificial selection is a mechanism that has brought a huge impact on the gene frequency of animals especially domesticated ones like dogs and cats. There are cases when breeding animals such as dogs resulted in diseases and malformation or abnormalities in the resulting offspring. Is s it proper to continue selective breeding? Support your claim and your answer in a bulleted format. this is not a writing assignment
Why do they look different? And why do they have different physical traits and phenotypes??
What specific observations (evidence) support the conclusions about sex determination in Drosophila and humans? Sort each observation to the appropriate bin. If an observation applies to both Drosophila and humans, sort it to the "Both" bin. If an observation does not apply to either Drosophila or humans, sort it to the "Neither" bin. Reset Help Three sets of autosomes per X chromosome are required for male fertility. Sex chromosomes are heteromorphic. Maleness is determined by lack of X chromosomes. Triploid individuals (3n) could be phenotypically normal females. XO individuals are male. More than one Y chromosome is needed for maleness. Diploid XXY individuals are abnormal males. Drosophila only Humans only Both Neither Submit Request Answer