Initiation of replication occurs at an "origin of replication" site that typically includes an AT-rich region. Initiation benefits from these AT-rich regions because:

During the process of transcription, the polymerase must handle several distinct polynucleotide chains: the double-stranded DNA ahead of the polymerase, the single-stranded template DNA, the nontemplate DNA strand, and the freshly-synthesized mRNA. How does the polymerase keep each of these strands--as well as the incoming ribonucleotides needed for the polymerase reaction--separate?

What is the difference from the polymerase used in transcription of mRNA and the polymerase used during DNA replication that occurs in the S Phase of interphase? What is

DNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MER-minus strain of yeast does not have a functional  mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MER-minus and wildtype yeast? More than one answer is correct. Options:   More point mutations will arise in MER-minus yeast.   Fewer point mutations will arise in MER-minus yeast as compared with wildtype.   Of the total point mutations that…

if you have the following sequence of DNA 5' ATTGCGGAGCCTCGAT 3' do the following:

Clustered sites where replication of multiple DNA molecules takes place are called transcription factories. a) True b) False

Imagine a bacterial cell with a mutation that renders helicase completely nonfunctional (note that this would be a lethal mutation). What, precisely, would go wrong with replication in this cell? Please describe what goes wrong, as well as all downstream effects.

After several rounds of replication, if COVID19 RNA changes from  5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’ to  5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAG …. 3’    Which of the following describes the above event?  a) an insertion mutation occurred b) a duplication mutation occurred  c) a multi-points mutation occurred  d) a point-series mutation occurred e) an inversion mutation occurred

Describe how the various operations of DNA replication are coordinated to ensure that a whole genome is correctly copied.