In your earlier research for this case study, you have discovered that nucleotides 1591-1593 (in the cDNA sequence, not CDS) are deleted in many CF patients causing a ΔPhe508 mutation in the CFTR protein. What are these three nucleotides in the CFTR cDNA sequence? Hint: you can copy the cDNA sequence from NCBI (with numbers) into a word processing program (e.g. Microsoft Word) to study the sequence or use a free DNA software program available by searching the internet.

A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420…

Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…

You can select multiple answers.

I recently isolated the human enzyme called fucosidase and prepared anantibody to it. Now I want to isolate a cDNA clone coding for this enzyme from a human cDNAlibrary. A friend of mine in the lab next door has informed me that he had recently isolated acDNA coding for dog fucosidase that I can use if I desire. In addition, I just read an article whichreported the sequence of the first 20 amino acids of human fucosidase. Which of the probeslisted below do you think I could use to screen my library to identify the cDNA clone containinghuman fucosidase?

Transcribe and translate the mutated sequence #1.  Determine the consequence, if any, for each mutation.  You will need to use your codon charts in your ISN.  Practice with both charts.

You identify a mouse mutant that has hemophilia and is unable to properly clot blood. Your assays reveal that a novel clotting factor is absent from the blood of the mutant mice. You sequence the genome of the mutant mouse and determine that clotting factor proteins normally associated with hemophilia are all wildtype (no mutations), but the coding sequence of the novel protein differs by one amino acid compared to wildtype. When you synthesize the mutant protein in vitro, it has normal blood clotting activity. Your controls using other mutant hemophilia clotting proteins fail to clot blood in this assay.   What would you say the mutant protein results in hemophelia?

A 19 year old female patient is diagnosed with chronic myelogenous leukemia. Karyotype analysis shows that the leukemic cells of this patient are heterozygous for a reciprocal translocation involving chromosomes 9 and 22. However, none of the normal, nonleukemic cells of this patient contain the translocation.  a) Describe a molecular test to determine if chemotherapy given to the patient described would be completely succesful. (That is, devise a method to make sure that the patient's blood would be free of leukemic cells.) Be as specific as possible.