Q: Describe the importance of the nitrogen and carbon cycles and the role of microbes in their…
A: Note:- Sorry, since you have posted multiple questions, as per the honor code, we will solve the…
Q: Which of the following is an advantage of asexual reproduction? (choose all correct answers)…
A: Asexual reproduction is a type of reproduction in which an organism gives rise to offspring having a…
Q: Consider a gram negative pathogen isolated from marine mammals. This pathogen is subjected to a…
A: Here in this question we are given certain characteristics and on the basis of it we have to…
Q: 18. During cytokinesis, plant cells form a a. Cell furrow b. cleavage furrow c. cell plate d.…
A: Cytokinesis is the final stage of cell division in which the cytoplasm splits between the two newly…
Q: Cross Section of Earthworm
A: Earthworm is a terrestrial invertebrate organism that is found in soil. The phylum of earthworm is…
Q: edigree and determine which of the following modes of inheri ait: dominant recessive minant essive…
A: A pedigree is made on different modes of inheritance that could be autosomal or sex linked.…
Q: Glucose uptake 100. 50. 25. 1.5mM 6mM 3mM 1 2 3 4 5 6 7 8 9 Extracellular conc. of Glucose Can't…
A: The picture shows the relationship between glucose uptake and extracellular glucose concentration.…
Q: A, B, and C are all examples of what general class of biomolecule? Please specify the correct…
A: We are given the image of the cell membrane and we need to identify the biomolecules attached to it.…
Q: otein? the mutation of a surface glu to an asp the mutation of an interior val to an ile the…
A: It is the clumping or misfolding of proteins. It can have adverse effects on the structure and…
Q: What letter in the diagram identifies the sporophyte? Which letter in the diagram indicates the…
A: The diagram illustrates the alternation of generations, a common life cycle observed in many plants…
Q: Show the calculations for the preparation of 0.01%, 0.001%, 0.0001%, 0.00001% standard DNA solutions…
A: The user is asking for calculations related to the preparation of various concentrations of a DNA…
Q: 1.state the principle and uses of real time pcr and microtiter plate 3.state two uses of distilled…
A: Real time PCR is based on the accumulation of amplification products. The quantification of these…
Q: O E A D a) purine, RNA O c) purine, DNA b) pyrimidine, RNA HC CH₂ d) pyrimidine, DNA CH CH-CH | →OH…
A: DNA aur RNA is a polymer of nucleotides. DNA is made up of deoxyribose sugar, a phosphate group and…
Q: Analyze the following pedigree and determine the mode of inheritance. Assume that the traits being…
A: The correct answer is option D. Sex-linked recessive.
Q: See image
A: AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT
Q: Calculez: 0.02cm+3.72mm+0.024m+230µm. Give the answer in mm (do not round off your answer, write…
A: A micrometer, often called a micron, is a unit of length in the metric system, symbolized as µm. It…
Q: It is possible to treat addiction by prescribing drugs that block the effects of the psychoactive…
A: Agonists are the drugs which attach to the receptor generating an identical response to the…
Q: Which of the following include the correct order of phases of a typical bacterial growth curve? log,…
A: Microorganisms grown-up in closed culture also called as a batch culture in that no nutrients are…
Q: 88 8 6 8 8 8 8 8 8 8 8 8 8 10 11 12 JOS COC 88 88 88 13 15 16 83 88 30 48 88 19 20 21 22 80 XY…
A: It is a medical condition caused by mutation or abnormalities in the gene of an organism. These can…
Q: Select all that apply. The fluidity of a biological membrane: is usually higher in plant cell…
A: Biological membrane is also known as cell membrane or plasma membrane. It is a selectively permeable…
Q: Which line represents the activation energy of the non-catalyzed reaction? Free energy L a. b. C. d.…
A: Answer : the graph which represents activation energy of non catalyst is : C) cexplaination : non…
Q: This pedigree (below) shows inheritance of a genetic disorder in a family. Assume the trait is rare.…
A: Gene is the segment of DNA responsible for heredity. Two or more alternative forms of genes…
Q: An organism has the chromosomes below where the letters represent genetic loci and the period…
A: Chromosome aberrations are modifications to the number or structure of chromosomes within the genome…
Q: Clonal amplification of DNA using microbiological organism faces challenges associated with (check…
A: A solid phase amplification of DNA fragments which helps in development of strong detectable signal…
Q: given a phage lysate with 10^11 pfu/ml and a bacterial culture with 10^8 cfu/ml, how would you…
A: phage lysate= 1011 pfu/mlbacterial culture= 108 cfu/mlMOI = 0.1You must combine the phage lysate as…
Q: 2 What is the pathophysiology of trauma?
A: Trauma, in the context of medicine, refers to physical injuries or wounds caused by external forces.…
Q: describe the folded fiber model of the mitotic chromosome the folded fiber model is based on…
A: A cell's life cycle may be compared to the cell cycle. In terms, it refers to the sequence of growth…
Q: Which of the following statements about the evolution of life on Earth, from simple prokaryote-like…
A: The evolution of life on Earth is a remarkable process that has led to the development of complex…
Q: Multiple T/F: A. Individuals with the common allele are expected to have identical DNA sequences at…
A: Beta globin locus is mainly made up of five genes that are located on a short region of Chromosome…
Q: When two inbred plants with triangular pods were crossed, the Fi plants all had ovate The resulting…
A: This is definitely a cross in which an allele apart from the main allele also determines the pod…
Q: Look at the pedigree below. If individual 3 marries a carrier for cystic fibrosis, what would be the…
A: A pedigree is a representation of the inheritance of a trait or character or disease from one…
Q: What is the 260/280 ratio when quantifying DNA? select the correct option below A. ratio of protein…
A: Deoxyribonucleotides are joined together by phosphodiester bonds to produce DNA, also known as…
Q: The image attached is a drawing of a Columnar Epithelium slide with the 40x objective lens. There…
A: The lining of the digestive tract (stomach, small intestine, and large intestine), the respiratory…
Q: Which of the following statements about the protein quality control system in the endoplasmic…
A: Endoplasmic reticulum is present in the cytoplasm, is a continuous membrane system consisting of…
Q: two mutational events are sufficient to cause some forms of cancer, what distinguishes familial…
A: Generally, individuals inherit one mutation that can increase the chances of cancer. This mutation…
Q: Parietal cells acidify the stomach contents while maintaining a neutral cytosolic pH by: O exporting…
A: The human digestive system relies on a specific cell type known as parietal cells. Parietal cells…
Q: You are planning a trip to Kansas, in the United States this summer. Which of the following pictures…
A: Climate and precipitation patterns regulate biome distribution across the world. Different regions…
Q: external lactose 0000 cell membrane RNA polymerase promoter The role of lac permease is to: lactose…
A: In bacteria, the genes that encode the enzymes of a metabolic pathway are usually clustered together…
Q: Which of the following is NOT true about enzymes? Enzymes are proteins Enzymes raise the…
A: In living things, enzymes serve as catalysts that are biological molecules, usually proteins. They…
Q: This is a picture of a plant that grows in the tundra with the common name arctic willow. Plants…
A: The tundra is an ecosystem characterized by extremely cold temperatures, low precipitation, and a…
Q: 0 O O 00 C 10% salt O The ce 10% ma O D Water molecules The solution inside the besker is: N sait…
A: This worksheet is based about a process called osmosis. Osmosis is a phenomena in which only solvent…
Q: Which codons do not have a matching tRNA? Select all that apply O UAA O AUG OUGA UGG OUAG
A: Transfer RNA (tRNA) is defined as a subclass of RNA molecules which is essential for the translation…
Q: Which of the following result do you expect to see from your experiment, and what problem you may…
A: Immunity is the term used for the ability of our body to fight against pathogens. Immunity is of two…
Q: A short fragment of a double-stranded DNA molecule is 100 nitrogenous base pairs in length. Adenine…
A: In the world of molecular biology, the structure of DNA holds a central role. The stability and…
Q: and each codon is made up of three nucleotide bases. How might an extra single base INSERTION into…
A: Any abrupt changes in DNA nucleotide is called muttaion.Depending on where the changes occurred…
Q: Which of the following is NOT a functional or structural change that occurs in the mesocorticolimbic…
A: The mesocorticolimbic dopamine system plays a crucial role in addiction, and exposure to addictive…
Q: 4. The interactions on the backbone (not the side chains) contribute to the (circle one):…
A: A protein is a polymer which is formed by a monomer amino acids that are linked together by peptide…
Q: Question 38 If human gametes were diploid the products of fertilization would have more…
A: DNA is the genetic material of living organism. DNA is a double stranded macromolecule that contains…
Q: what role does the brain play in hunger regulation and dysregulation
A: The brain manages our hunger. It has a "hunger center" and "fullness center" in the hypothalamus.…
Q: Describe and draw the spinocerebellar pathway, dorsal column-medial lemniscal pathway, spinothalamic…
A: Temperature, light touch, pressure, tickle, and itch sensations are transmitted by the…
Step by step
Solved in 3 steps
- Oxidation of ingested CHO during exercise depends on each of the following variables except... Group of answer choices CHO flavor. ingested amount. exercise intensity. type of CHO.(1) Please explain about this schematic illustration "clearly" (2) explain about the function and benefit of this graphic Schematic illustration of energy liberation, energy expenditure, and heart rate at steady state workState the equation for total-body energy balance. Describe thethree possible states of balance with regard to energy storage?
- From the table below which shows the metabolic rate for each activity, if a person with height 1.50m and weight of 60kg completed all these activities in one day. Calculate the person's one day energy expenditure using Harris-Benedict Equation. Activity8hr sleeping (35 Cal/m^2 -hr)8hr moderate physical labor (150 Cal/m^2 -hr)4hr reading, writing, TV watching (60 Cal/m^2 -hr)1hr heavy exercise (300 Cal/m^2 -hr)3hr dressing, eating (100 Cal/m^2 -hr) A. 569.33 cal B. 850.20 cal C. 996.07 cal D. 720.50 calDuring strenous exercise, glucose is primarily converted to?From the table below which shows the metabolic rate for each activity, if a person with height 1.50m and weight of 60kg completed all these activities in one day. Calculate the person's one day energy expenditure. Activity8hr sleeping (35 Cal/m^2 -hr)8hr moderate physical labor (150 Cal/m^2 -hr)4hr reading, writing, TV watching (60 Cal/m^2 -hr)1hr heavy exercise (300 Cal/m^2 -hr)3hr dressing, eating (100 Cal/m^2 -hr)
- From the table below which shows the metabolic rate for each activity, if a person with height 1.50m and weight of 60kg completed all these activities in one day. Calculate the person's one day energy expenditure. Activity8hr sleeping (35 Cal/m^2-hr)8hr moderate physical labor (150 Cal/m^2-hr)4hr reading, writing, TV watching (60 Cal/m^2-hr)1hr heavy exercise (300 Cal/m^2-hr)1hr dressing, eating (100 Cal/m^2-hr) A. 569.33 cal B. 850.20 cal C. 996.07 cal D. 720.50 calDescribe the three possible states of balance with regard to energy storage.What are the major energy stores of the body, that are used as substrates for fuel during exercise? Be specific.
- Endurance athletes sometimes follow the exercise-and-diet plan described here: 7 days before an event, do exhaustive exercises so as to all but deplete glycogen stores. For the next 2 to 3 days, consume few carbohydrates and do moderate- to low- intensity exercises. Finally, 3 to 4 days before the event, consume a diet rich in carbohydrates. Explain the benefits of this regime.According to Hall et al., the energy balance system is interactive and complex. True FalseDefine a kilocalorie and how might this concept be applied to the field of exercise science? Provide a brief example of how a MET may be converted to a caloric equivalent.
