88 8 6 8 8 8 8 8 8 8 8 8 8 10 11 12 JOS COC 88 88 88 13 15 16 83 88 30 48 88 19 20 21 22 80 XY deletion trisomy translocation monosomy about us careers privacy policy terms of use. contact us help

ment/d/1d1MOGCJCGjZYwhcUOWDBulan-NwWpIRg/edit utations .DOCX t Tools Help Last edit was 9 minutes ago nal text Times New... | c ñ I a + 二次 =t|^三| 11 1. Will there ikely be etects? 5. What type of mutation is this? 2. 4. Mutated DNA Sequence #2 TACGAC CTTGG CGA C GACT What's the mRNA sequence? amino acid sequence? Will there likely be effects? What type of mutation is this? Mutated DNA Sequence #3 TACA CCTTAGCGA CGACT... (Highlig. What's the mRNA sequence? amino acid sequence? Will there likely be effects? What type of mutation is this? Mutated DNA Sequence #4 TACAC CTTGG CGACTACT... (Highligh. What's the mRNA sequence? amino acid sequence? Will there likely be effects? What type of mutation is this? dy

A male presenting with clinical features as greater height, poor coordination, less body hair, breast growth and seems less interest in sex. He is also facing difficulty in speech. What your knowledge depicts that he is suffering from which genetic disease.

tus: Second letter с A UUU Phe UUC J UCU UC UAU UAC J Ser UAA Stop UGA Stop A Tyr UGU] UGC Cys UUA UUG J Leu UCA UCG UAG Stop UGG Trp CUU CỤC CỦA CUG CCU] CC CCA CG CGU CGC CAU1 CAC J CAA CAG His Leu Pro Arg CGA Gln CGGJ AUU AUC le ACU ACC ACA AAUJASN AGU S Asn Ser AGC AGA Arg Lys Thr AAA AAGJ AUA AUG Met ACG AGG GAUASP GGU] GGC GGA GGG GUU GCU GUC GUA GCC GCA GCG GACJ Ala GAA GIU Val Gly Glu GUG GAGJ The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGG1 3. Starting from the start codon, what is the third amino acid incorporated into the polynantide chaina O1. Cys Met Glu IV. Gly Third letter UCAG UCAG UCAG UCAG C. A. First letter