In the following figure, provide RNA sequence of Gene a and Gene b in a 5'-3' direction. Provide the DNA sequence of Gene c on the non-template strand. 4. Genes a and c are transcribed from the bot strand,... RNA DNA Gene b Gene c 5' 3' Gene a GGACCTA 3' 5' ACGTCAG RNA RNA UUAGAUC ...and b is transcribed from the top strand.

Consider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?

To test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…

a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR =  3'UTR =

Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino acids: 5'-ATGTCGTATCCCCGG-3' a. What is the sequence of the mRNA? Write your answer 5' to 3', but do not label ends. b. What is the encoded pentapeptide? Please write your answer in the form of: Pro-Thr-Asn c. You sequenced your labmate's provided gene, and found the following sequence: ATGTCATATCCGCGG. Will your labmate get their protein of interest from this sequence? (Yes or No?)

5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription start site is bold. Transcribe template DNA to mRNA. Make sure you write mRNA in the 5’ to 3’ direction. This is tricky – don’t assume the polymerase knows right from left. It can only synthesize new DNA in 5’>3’ direction.

The sequence of a segment of mRNA, beginning withthe initiation codon, is given here, along with the corresponding sequences from several mutant strains.Normal AUGACACAUCGAGGGGUGGUAAACCCUAAG...Mutant 1 AUGACACAUCCAGGGGUGGUAAACCCUAAG...Mutant 2 AUGACACAUCGAGGGUGGUAAACCCUAAG...Mutant 3 AUGACGCAUCGAGGGGUGGUAAACCCUAAG...Mutant 4 AUGACACAUCGAGGGGUUGGUAAACCCUAAG...Mutant 5 AUGACACAUUGAGGGGUGGUAAACCCUAAG...Mutant 6 AUGACAUUUACCACCCCUCGAUGCCCUAAG...a. Indicate the type of mutation present in each, andtranslate the mutated portion of the sequence intoan amino acid sequence in each case

Identify the type of point mutation on the following strands (transition or transversion): a. 5’ TACTGCA 3’          5’ TATTGCA 3’     3’ ATGACGT 5’          3’ ATAACGT 5’ b. 5’ CGACGTTA 3’            5’ CGAGGTTA 3’     3’ GCTGCAAT 5’             3’ GCTCCAAT 5’c. Which of these types is more common and why?

The map of plasmid pUC19 is shown below.  The restriction site coordinate is the position of the 5’base on the top strand of each site sequence.  The restriction enzyme sites are in bold type if there is only one site in pUC19. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme PvuII. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme DrdI.

Provide the sequences of the template and coding strands of a DNA double helix that was used toproduce this RNA: 5’-GUUACCGACUAU. Be sure to label the 5’ and 3’ ends.