In the following C code, how many times the value i is checked in the condition i < 6? #include int main() { int i = 1; do { i+t; if (i == 5) {break;} printf("in while loop %d\n"i); } while (i < 6); }

In the following C code, how many times the value i is checked in the condition i < 6? #include int main() { int i = 1; do { i+t; if (i == 5) {break;} printf("in while loop %d\n"i); } while (i < 6); }

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: 1 #include 2 3 int main() 4{ float y; 7 scanf("%f",&y); 8. 9. switch(y) { 10 11 case 1.1: 12 13 14…

A: The solution to the given problem is below.

Q: In c++ how can i create a code which checks that the cost of certain items added together has…

A: The answer to the following question:-

Q: hello executable 4. Write the function playGame to do the following a. Return type void b. Empty…

A: void playGame() { char playerX[20]= NAME; char playerO[20] = NAME; int currentPlayer =1; int…

Q: 1) Define a global variable Emps that is an array of pointers to employee structs. 2) Change your…

A: According to the question , we have to solve 5 parts in the questions but we will discuss first…

Q: Computer Science Flowchart for this code Please C PROGRAM: #include unsigned int x; sbit P11 = P1^1;…

A: Flow chart is given below

Q: void funOne(int a, int& b, char v); void main() { int num1=10; char ch='A'; funOne(num1,…

A: Invalid

Q: Exercise 1 Write a C++ program that will check if a given number (provided by a user) is prime or…

A: I have written the code in C++ to check whether a number given as input by the user is a prime…

Q: Rewrite the following code using while loop statement instead of for loop statement in C++. #include…

A: We need to rewrite the program using while loop in the place of for loop. Here the loop ranges from…

Q: Ensure that the loop repeats 10 times int r = 100; for (;r >= 1;) { }

A: In computer programming, a loop is a method that enables you to repeat one or more instructions…

Q: Input A line containing an integer. 214 Output Multiple lines containing an integer. 4 1 2

A: I have provided C++ CODE along with CODE SCREENSHOT and 2 OUTPUT…

Q: in C++ PLEASE #include #include #include #include #include #include #include #include…

A: Solution: This program is an implementation of the producer-consumer problem using…

Q: QUESTION 23 Given int *ptr, x[6]={11, 238, 4, -70, 9, -53); What the following statement does?…

A: The given code: *(x+3)=12

Q: int x =9; do { x++; } while( x < 10); will give an infinite loop. O True O False

A: The answer is False. The code given above will not give an infinite loop.

Q: 1) Define a global variable Emps that is an array of pointers to employee structs. 2) Change your…

A: The solution to the given problem is below. ***According to Bartleby policy we are allowed to…

Q: Code in Java using Break Statement This code should use break statement (see more details in the…

A: I have provided JAVA CODE along with CODE SCREENSHOT and OUTPUT…

Q: NOTE: Make sure and include comments in your program. At a minimum it should include the author's…

A: Algorithm :- 1. Start 2. Initialize number of grade n 3. Input the value of n 4. Call gradeAverage()…

Q: 1. Implement a Student class. a. Create a class Student with the following private data members: 1.…

A: Class is a user-defined data type that contains the data members to store the values. The member…

Q: Student Registration System is an approach that enables colleges and universities to better…

A: Declare the variables and array of strings. Using while loop which condition if the ch is not equal…

Q: In c++ how can you read a textfile that contains numbers and arrange those numbers in ascending…

A: Content of numbers.txt Output

Q: #include int i = 0; #define loop for(;i<3;i++) int main () { char *chegg_ptr loop printf (chegg_ptr…

A: Answer : Cheggheggegg is the output of the above C program.

Q: 2.Using a "For loop" function, create a program which stores your four favorite movies/anime an…

A: Algorithm: Start Read title and year of the 4 movies and store them 2 different arrays Using for…

Q: Write an expression that executes the loop while the user enters a number greater than or equal to…

A: Start the program.Declare an integer variable userNum to store the user's input.Prompt the user to…

Q: Every line of this c program please explain. Thank you Source Code: // include necessary…

A: //include hearder files for using C++ supported library//include cin, cout, etc libraries#include…

Q: #include /* print Fahrenheit-Celsius table for fahr = 0, 20, ..., 300; floating-point version /…

A: Given: We need to update the code to use the for loop. The code is given below:

Q: How many times will the loop repeat

A: Given :- In the above question, the code fragment is mention in the above given question Need to…

Q: If integer cardCount is: 36, output "Short deck". 52, output "Standard". Otherwise, output "Another…

A: The problem involves determining the type of deck based on the number of cards. Given an integer…

Q: Instructions Ensure the source code file named MovieGuide.cpp is open in your code editor. Write…

A: Program description: The c++ program objective is to prompt users to enter the rating for a featured…

Q: Write an application named MultiplicationTable that prompts the user for an integer value, for…

A: ALGORITHM:- 1. Take input from the user for the number. 2. Use a while loop to traverse from 1 to…

Q: Create a program that will be used as a POS (Point of Sale) system in a restaurant. The bill_total…

A: algorithm of the code :- 1. Enter the total bill amount : 2. individual_bill = bill_total /…

Q: n this lab, you write a while loop that uses a sentinel value to control a loop in a C++ program…

A: The added code in the do-while loop with sentinel value: if(numStars < 0){ break;…

Q: C Programming Problem: In your annual examination you are given two numbers X and Y. Below are some…

A: Here is the code with output:-

Q: main() { int a = 1, b = 2, c = 3: printf("%d", a + = (a + = 3, 5, a)) } Output…

A: Solution -: Given code is : main() { int a = 1, b = 2, c = 3: printf("%d", a + = (a + =…

Q: This is the C code I have so far #include <stdio.h> #include <stdlib.h> struct…

A: As per our guidelines, we are supposed to answer only 1st three parts. Kindly repost the remaining…

Q: Flowchart for this code Please

A: We need to draw the flowchart of the code- #include<win51.h> unsigned int x; sbit P11 = P1^1;…

Q: Overview In this assignment, the student will write a C++ program that identifies a non-negative…

A: Note: Below is the required C++ program. Program Approach: Declaring necessary header file Using…

Q: C program only Hi! The 'divide' function should apply recursion. Please fix the code below.

A: In this question, a code is given in C language which divides the two numbers and we have to…

Q: 2. Add the code to display the first two building sections below the top of the tower, all still…

A: C++ program to complete the above code and print the given output using for loop.

Q: When I was a kid, I used to watch this TV game show, Deal or No Deal? in the game, there are…

A: Iterate over the array from beginning to ending and compare each and every element with the input…

Q: C++ Using the code provided below Do the Following: Modify the Insert Tool Function to ask the user…

A: I have given C++ Code without error, hope you like it.

Q: Given C code: #include typedef struct compound { float realNumber; float imaginaryNumber; }…

A: I have changed your logic in compound function which was previously returning addition of two…

Q: C#Write a method MyMethod which takes an int parameter named x. This method calculates the sum of…

A: Given: C#Write a method MyMethod which takes an int parameter named x. This method calculates the…

Q: OUTPUT CONSOLE class Performance Calculator I Please insert number of students: 5 [Enter] Please…

Q: game #4 player 1 : rock player 2 : rock playerl = 1, player2 = 1 Notice this game scores didn't cha…

A: #include<iostream> #include<cstdlib> #include<ctime> int main(){ unsigned…

Q: The Worksheet named Grades contains a place for students to record the grades they have received in…

A: Sub showValue() Dim arr(9) For i = 0 To 8 Step 1 arr(i) = Range("B" & (i + 2)) Next…

Concept explainers

Types of Loop

Loops are the elements of programming in which a part of code is repeated a particular number of times. Loop executes the series of statements many times till the conditional statement becomes false.

Loops

Any task which is repeated more than one time is called a loop. Basically, loops can be divided into three types as while, do-while and for loop. There are so many programming languages like C, C++, JAVA, PYTHON, and many more where looping statements can be used for repetitive execution.

While Loop

Loop is a feature in the programming language. It helps us to execute a set of instructions regularly. The block of code executes until some conditions provided within that Loop are true.

Question

In the following C code, how many times the value i is checked in the condition i < 6?
#include <stdio.h>
int main()
{
int i = 1;
do {
i++;
if (i == 5) {break;}
printf("in while loop %d\n",i); }
while (i < 6);
}

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

In C++
coding language in c++ using for loops and nested for loops
Create a Flowchart for this code
Rewrite the following code using while loop statement instead of for loop statement in C++. #include using namespace std; int main() int i, reps; double usenum, postot(0), negtot(0); cout > reps; for(i = 1; i > usenum; if (usenum > 0) postot = postot + usenum; else negtot = negtot + usenum; cout << "The negative total is " << negtot << endl; return 0;
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Computer Science Part C: Interactive Driver Program Write an interactive driver program that creates a Course object (you can decide the name and roster/waitlist sizes). Then, use a loop to interactively allow the user to add students, drop students, or view the course. Display the result (success/failure) of each add/drop.
Assignment: Simplifying C Code Description: Reduce the C snippet on the next page to the most basic components possible, as discussed in the lecture. For instance, please try to eliminate the following language components, replacing them only with if/goto blocks: ● for loop while loop ●. switch statement . curly brackets { } (other than those surrounding main) += and -= notation Once complete, test your code and the original code with a few different initial values! Deliverables: Your simplified C code, in a plaintext (.txt) file A screenshot of the simplified code running, showing it produces the same output as the original. Using BF computer language.
Find errors / syntax error. Write line number
Using a Sentinel Value to Control a while Loop in C++ In this lab, you write a while loop that uses a sentinel value to control a loop in a C++ program that has been provided. You also write the statements that make up the body of the loop. The source code file already contains the necessary variable declarations and output statements. Each theater patron enters a value from 0 to 4 indicating the number of stars the patron awards to the Guide’s featured movie of the week. The program executes continuously until the theater manager enters a negative number to quit. At the end of the program, you should display the average star rating for the movie. Instructions Ensure the source code file named MovieGuide.cpp is open in your code editor. Write the while loop using a sentinel value to control the loop, and write the statements that make up the body of the loop. The output statements within the loop have already been written for you. Ensure you include the calculations to compute the…
This is the C code I have so far #include <stdio.h> #include <stdlib.h> struct employees { char name[20]; int ssn[9]; int yearBorn, salary; }; // function to read the employee data from the user void readEmployee(struct employees *emp) { printf("Enter name: "); gets(emp->name); printf("Enter ssn: "); for (int i = 0; i < 9; i++) scanf("%d", &emp->ssn[i]); printf("Enter birth year: "); scanf("%d", &emp->yearBorn); printf("Enter salary: "); scanf("%d", &emp->salary); } // function to create a pointer of employee type struct employees *createEmployee() { // creating the pointer struct employees *emp = malloc(sizeof(struct employees)); // function to read the data readEmployee(emp); // returning the data return emp; } // function to print the employee data to console void display(struct employees *e) { printf("%s", e->name); printf(" %d%d%d-%d%d-%d%d%d%d",…
C++ Plz solve as you can quickly
Please written by computer source In C# pseudo-code answer this question: