i need the answer quickly In cichlid fish, GNRH becomes increasingly active in the brain cells of:O A dull color fishO A bright color aggressive fishO An aggressively territorial fish

GnRH: Gonadotropin-releasing Hormone is the releasing hormone and key regulator for reproductive…

Answered: In cichlid fish, GNRH becomes…

In cichlid fish, GNRH becomes increasingly active in the brain cells of: A dull color fish O A bright color aggressive fish An aggressively territorial fish

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter56: Animal Behavior

Section: Chapter Questions

Problem 5TYK

See similar textbooks

Related questions

Q: What is the main reason for archiving your phage? so that you could repeat the DNA isolation (for…

A: The answer is to store your phage long term so that anyone who accesses the phage database could…

Q: Change in gene frequencies within a reproductive population is called: O allopatric speciation. O…

A: Evolution is defined as a change in the inheritable traits of biological populations, over multiple…

Q: the adaptations that Orobanchaceae (plant) has evolved to invade and manipulate the hosts (talk…

Q: 2. The largest population an ecosystem can support is the carrying capacity determine by the which…

A: Ans: 2 Carrying capacity, limiting factors Explanation: The largest population an ecosystem can…

Q: In case of a plant virus going viral, what actions do you think should be made to improve our food…

Q: why do populations of sardinian villagers have different pv92+/-Alu allele frequencies?

A: geographic distances between villages shows a rapid decline of kinship with increasing distance but…

Q: What does the color of Leo’s urine tell you about how concentrated or diluted it is? What about his…

A: 1.Before exercise leo is well hydrated because his urine color is pale yellow this is also supported…

Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT

Q: RNA that, combined with protein into multiple sun bits, constructs a peptide chain must be called…

A: RNA that, combined with protein into multiple sun bits, constructs a peptide chain must be the tRNA.…

Q: Which of the following images shows a phage with a Siphoviridae morphotype? A) B) C)

A: Siphoviridae viruses are double stranded DNA viruses which belong to order Caudovirales. this family…

Q: Solve in digital format to be able to pass it to word Look at the following scheme: why we say that…

A: Metabolism is defined as the entire quantity of biochemical events that occur in an organism's cells…

Q: ALL ANSWERS MUST RELATE TO THE NATION CHILE 4- Biosphere / Environmental Sustainability Challenges:…

A: Ans: Chile is a Latin American country and comes under the 35 world's biodiversity hotspots due to…

Q: 1 Why is the bulk milk hauler an important link in assuring high-quality milk for humans? What…

A: Bull milk contain high amount of calcium and minerals. These are necessary for bone develpoment.…

Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…

A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…

Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…

A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…

Q: 9. Suppose you accidentally introduce a small plant-eating beetle into your self-contained…

A: You construct a self-contained ecosystem in a jar, following some instructions. Your ecosystem…

Q: 2/. How do plants and animals regulate their body fluids? Why do you think body regulation is…

A: It is critical to learn and know the anatomy and physiology of the body. Many changes in the animal…

Q: of most hemoglobins when: 1. deoxygenated blood enters the capillaries in the lungs. 2. oxygenated…

A: Answer :: Hemoglobin-oxygen dissociation curve as the name suggests describes the relation…

Q: are bacterial cells eukaryatic or prokaryotic?

A: Cell is a microscopic structure exhibited inside the living organisms . It can be one in number or…

Q: 5) cranial nerve II, the optic nerve sends nerve impulses to the brain carrying information about…

A: It is critical to learn and know the anatomy and physiology of the human body. Many changes in the…

Q: Provide an example of a well known group (taxonomic) name that has been rendered non-monophyletic…

A: Answer :- Taking care of the fundamentals of taxonomy categorization and how to peruse phylogenetic…

Q: Describe the features of the fluid mosaic model of the cell membrane.

A: Cell membrane It is defined as the membrane that protects the cell from its environment by…

Q: When present, the TATA, CAAT and GC boxes are typically found within 100 - 150 bp upstream from the…

A: The TATA box is a conserved nucleotide sequence located around 25-30 base pairs upstream of the…

Q: You are recording from a touch receptor in skin. When you stimulate a spot on the skin, the receptor…

A: Answer :- Option (B) is correct. - Whether the receptor sends its output to the somatosensory cortex…

Q: A protein that has been reversibly denatured has Multiple Choice temporarily lost part or all of its…

A: Answer :- Option (C) is correct. - Temporarily lost part or all of its secondary and tertiary…

Q: Match the concept in column A to the concept in column B. Write the letter of the correct answer on…

A: Molecular biology is the study of biological processes at molecular level. It includes various…

Q: Aa al 1 No Spac. Heading 1 Неа Lu Am Ma pod mbs Amnion Liz and Cra Ost Feathers Haw othe

A: Phylogenetic tree represents the evolutionary relationship between different organisms. The node…

Q: what is the current population of hawks?

A: Hawks (family Accipitridae) are one of the major groups of predatory birds that are active during…

Q: O5-CAGCAUUA-3'

Q: When comparing Gastropoda with bivalvia, is the relationship monophyletic, polyphyletic, or…

A: Mollusks are soft-bodied animals and the body is divisible into visceral mass and foot. The visceral…

Q: Why the synergy test results demonstrated that Penicillin G and Gentamicin did not act…

A: Penicillin G is an antibiotic that is used to treat bacterial infections. Pneumonia, strep throat,…

Q: Give economic and ecological significance of Oats (Avena)

A: Introduction Oats (Avena):- The oat, sometimes called the common oat, is a domesticated cereal grass…

Q: Model 5, continued... 36. As electrons are passed down the ETC, from one member to the next, small…

A: Electron transport system is a system, which involves a series of electron carriers of coenzymes and…

Q: does chain abberation due to translocation mutation result to fertile gametes

A: Translocation is a structural change in the chromosome and includes the exchange of chromatin…

Q: Explain in detail how phosphorylation of retinoblastoma (rb) protein leads to transition of the cell…

A: The RB1 (retinoblastoma 1) gene codes protein called pRb. It is a tumor suppressor gene (genes whose…

Q: You take a sample of cancerous tissue from Individual II-6 from the prior question. What will the…

A: X- linked inheritance X linked inheritance is a pattern of inheritance when the trait is controlled…

Q: How can a person reduce their own food waste? O Use clean energy in food production facilities and…

A: Only buy food if you have a limited supply.Don't overcook your food.Refrigeration is a good way to…

Q: Mutating the gene Transformer (tra) in Drosophila that is chromosomally XX leads to the development…

A: A mutation is a change in an organism's DNA sequence. Mutations can occur as a result of mistakes in…

Q: Why do scientists isolate DNA?…

A: There are different techniques to study DNA and gene present in it.

Q: Ant species work together to collect food and build the mounds they live within. This behavior…

A: Ants are distributed in all different habitats and everywhere on the planet but less in Antarctica,…

Q: Generally, one single mutation is enough to cause cancer. [Select] Cancer-causing mutations cause…

A: When the genes that control cell division are disrupted, cancer cells are produced. Carcinogenesis…

Q: From the early 1700s to the modern day, how did various lines of evidence refine scientists'…

A: Cetacean is classified as a group that comprises whales, and dolphins along with the porpoises.…

Q: Assignment in Modules 4-6 Matching Type: Match Column A with Column B. Type the answer before the…

A: When the body fails to carry out the normal metabolic functions due to rare genetic conditions it…

Q: My field is COSMETIC SCIENCE What information can be obtained from UV-vis Spectra and how this can…

A: Ultraviolet Visible spectroscopy (UV-Vis spectroscopy) is an analytical technique, which measures…

Q: Did you have an experience when a stranger acted caring and was helping you? What impact did that…

A: Empathy creates a connection that enables us to feel compassion. We can sense the suffering of…

Q: TRUE or FALSE? Sexual selection can only occur if the features and/or behaviors associated with it…

A: Natural selection is the interaction through which populaces of living beings adjust and change.…

Q: 1. Use the below pedigree chart to answer the following questions about dimples. The Dimple gene…

A: The genotype of a cell or organism is the genetic code of that cell or organism. The sum of all…

Q: Explain what happens to urine flow rate, specific gravity and urinary excretion of chloride in each…

A: As it is mentioned in the question the intake is isotonic that means the osmolarity of the intake…

Q: The carpel (pistil), the female reproductive organ of a flower, consisting of _______, ________ and…

A: sexual reproduction is the soil function of the flowers which are the showiest part of plant Flowers…

Q: A cladogram or phylogenetic tree is used to classify organisms into groups based on their shared…

A: A cladogram or a phylogenetic tree is a type of evolutionary tree showing representation or…

Question

i need the answer quickly

In cichlid fish, GNRH becomes increasingly active in the brain cells of:
O A dull color fish
O A bright color aggressive fish
O An aggressively territorial fish

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following changes are most likely to occur in a male songbird that has a mutation in the cells in its anterior pituitary gland such that FSH and LH are produced at 1% of normal levels? increased courtship displays to attract females decreased GnRH production increased testosterone production decreased frequency of "singing" to attract females Submit Request Answer
Large testes are probably advantageous in species with sperm competition because larger testes produce more sperm which increses males' probability of fertilization females choose males based on testes size more testosterone production increases fighting ability of males larger testes produce larger sized sperm which have a competitive advantage over other sperm
What does VMN do in males VS females in vertebrates?
In sharks hormones regulate which of the following functions? Digestion Growth Stress responses Lactation The lymphatic system Smell Defecation Osmoregulation Reproduction Color change and bioluminescence Leckking behaviour
Describe hormonal control of metamorphosis in insects, including the action of each hormone and where each is produced
Animals attract mates through a variety of behaviors. Diurnal animals tend to rely on visual cues, while nocturnal ones make frequent use of pheromones. In recent years, environmental pollutants called endocrine disruptors are on the rise. Such chemicals mimic hormones in higher-order animals and interfere with the reproductive cycle. Which animal’s reproduction would be most seriously affected in the presence of endocrine disruptors? rats bees fireflies fiddler crabs
Female spotted sandpipers aggressively court males and, aftermating, leave the clutch of young for the male to incubate. Thissequence may be repeated several times with different males untilno available males remain, forcing the female to incubate her lastclutch. Which of the following terms best describes this behavior?(A) polygyny(B) polyandry(C) promiscuity(D) certainty of paternity
We discussed environmental sex determination in reptiles, where the sex of the individual is determined by environmental factors rather than chromosomes. Which of the following modes of sex determination would also fit that category? hermaphroditic earthworms hermaphroditic hermaphroditic all of the above nudibranchs (the "penis fencers") coral reef fish
Spiders Use venom to liquefy the protein rich bodies of their prey O Exchange respiratory gases through spines on their legs O Typically use their mandibles to shred prey before swallowing the pieces All of the above Fertilize eggs after they are laid by the female (spawning)
In sea urchin, which step of egg and sperm recognition is mediated by sperm-activating peptides? Sperm migration through the egg ECM Fusion of the sperm and egg membranes Sperm binding to the egg's ECM Acrosomal reaction Chemo-attraction
Parasites are often microscopic in size but have large negative effects on their hosts. If this is true for the parasites of songbirds, what predictions follow about their effects on male song performance, and how should females respond to the song of infected males as opposed to uninfected individuals (Garamszegi 2005)? (Don't use any online source)
Animals attract mates through a variety of behaviors. Diurnal animals tend to rely on visual cues, while nocturnal ones make frequent use of pheromones. In recent years, environmental pollutants called endocrine disruptors are on the rise. Such chemicals mimic hormones in higher-order animals and interfere with the reproductive cycle.