If Marge’s father is a heterozygous tall Zork and her mother is a short Zork, what isMarge’s genotype?Complete the Punnett square to show the possible genotypes that would result to help you determine Marge’s genotype.What is Marge’s genotype
Q: 1. What is the significance of the formation of the blastocoel and blastoderm during blastulation? 2...
A: Blastulation It refers to the production of blastula during the early stages of animal embryonic dev...
Q: Which of the fat-soluble vitamins is needed for building bone, muscle contraction, and nerve impulse...
A: Introduction : Fat soluble vitamins are soluble in organic solvent or we can say that these are abs...
Q: In squash vegetable: What are the enzymes, pigments, flavors present in squash?
A: Squash is a plant that comes in a variety of shapes and sizes. Squash is one of the most adaptable f...
Q: 1. Describe what malaria is and where it is prevalent in what areas of the globe and in what habitat...
A: Often diseases are caused by various pathogenic microbes that are found in unhealthy and unhygienic ...
Q: Make a simple sketch of meiosis in a cell with a diploidchromosome number of 4. Now try it when the ...
A: The basic structural and functional units of heredity are genes. They are made up of deoxyribonuclei...
Q: A 60-year-old woman with history of lung cancer is admitted for weakness and lethargy for 4 weeks. H...
A: The correct option is C.
Q: a far point of 5 m. Spectacles that enable them to see distant
A: Optical power is the degree to which a lens,mirror or other optical system coverages or diverges lig...
Q: Which of these best describes the population growth shown in the graph? 0 1 2 3 4 5 Days A. On day 1...
A: Amoung the following the best one which describes the population growth is E. On day 5, the number ...
Q: Q8. Protein synthesis is carried out by the processes of transcription and translation. A short leng...
A: The transcription is the process by which RNA is produced from the DNA template and the translation ...
Q: d) Since we know this bacterial organism thrives in colder areas of the world, what can be said abou...
A: NOTE: We are solving parts d and e as mentioned by you. Bacteria that can survive cold temperatures ...
Q: Create a flow chart on how to prepare a nutrient agar
A: Nutrient Agar ...
Q: Corn has a chromosome number of 2=20. Supposing there are different aneuploidy/polyploidy in corn, p...
A: The sex chromosomes decide an individual's sex. The majority of people have two sex chromosomes, one...
Q: In mice, agouti fur color is dominant overr albino fur. Complete a Punnett square that crosses a het...
A: Given, agouti color fur in mice is dominant over albino fur. It is also given to cross a heterozygou...
Q: Which of the following characteristics of a water-insoluble substance is most important in governing...
A: Lipids solubility of a water insoluble substance play most important role in governing its diffusibi...
Q: Which type of the following play a role in the gravitropic response of plants according to the stato...
A: Statoliths hypothesis Gravity perception is best explained by the starch–statolith hypothesis that s...
Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...
A: The hereditary material in humans and almost all other organisms is DNA or deoxyribonucleic acid. Th...
Q: 1) What makes the heart sounds? 2) Know the whole cycle/route that the blood takes from the heart th...
A: 1.Blood does not pass back from the atria into the great veins because the roots of great veins are ...
Q: Enumerate 5 important features of the DNA. Choose ONE from your list and elaborate on how this feat...
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each ...
Q: which of the following is true of chemical signals? - they can only be perceived by the intended re...
A: Chemical signals utilise different neurotransmitters or chemicals( hormones) which act on the intend...
Q: 3. Describe the effect of malaria on the frequency of the Hbs allele in areas where is common in are...
A: Sickel cell anemia is a genetic disease in which the RBCs present in the blood changes its shape fro...
Q: 5. Draw the reaction curve for the follow a) A reaction with an activation energy (EA) = 50 and free...
A: Activation energy is the energy required for a chemical reaction to occur. Free energy is available ...
Q: Acetylcholine: is the neurotransmitter in the parasympathetic nervous system. is the neurotransmitte...
A: Introduction: acetylcholine is a neurotransmitter, it is an ester of choline and acetic acid. acts a...
Q: List the sequences of RNA that would be transcribed from the following DNA template sequences. TTAC...
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. It contain genes that ...
Q: Phenylethyl alcohol and why would it be useful in agar
A: Acoording to this question we have to decribe phenyl alcohol and the phenylethyl alcohol be useful i...
Q: The offspring of the cross AA × aa are______ . a. all AA c. all Aa b. all aa d. half are AA and half...
A: The term Punnett square is associated with the table that plays an important role in describing the ...
Q: The role of creatine phosphate in muscle cells is to: provide energy for muscles during extended phy...
A: Creatine phosphate serves as an “energy buffer” in muscle it is a high-energy, phosphorylated, nitro...
Q: After adding ammonium sulfate, the mixture was allowed to stand with occasional stirring for 30 minu...
A: Salting out refers to the decrease in solubility of proteins in the presence of very high salt conce...
Q: The statement “DNA replicates by a semiconservative mechanism” means that (a) only one DNA strand is...
A: Introduction DNA replication is a semi-conservative and semi-autonomous process. Semi-autonomous me...
Q: In fruit flies, brick-red eye color is dominant to a bright orange color called cinnabar. A fruit fl...
A: Genetics is the study of the functioning and main codes of variation and heredity. Inheritance is th...
Q: Give the functions of the following bacterial structures. Cell wall Cell membrane LPS Ribosomes Nuc...
A: Bacteria are prokaryotic , ubiquitous microscopic structure which is one celled and is without any t...
Q: plant begins the process of photosynthesis with 50 kCal worth of light energy, how much energy will ...
A: The question is related to 10% energy law.
Q: which cellular function is performed by only some types of cells? obtaining nutrients and chemical ...
A: Cells must perform functions in order to support and maintain life, that is cellular functions, such...
Q: 3. The presented sequences are coming from one ancestral sequence. Through RE, the ancestral sequenc...
A: DNA sequencing is a laboratory technique used to determine the exact sequence of bases (A, C, G, and...
Q: 5. Which correctly describes a process or event in the female repro- ductive cycle? A. The cycle is ...
A: The correct Answer is E
Q: The table below summarises the three stages of Meselson and Stahl's experiment and their results. (a...
A: While proposing the double helical structure of DNA Watson and crick had immediately proposed for r...
Q: Independent assortment means .a. alleles at one locus assort into different gametesb. alleles at dif...
A: Introduction Sir Gregor Mendel is known as the Father of Genetics. He was the pioneer scientist who...
Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...
A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...
Q: Can you please help me answer the following questions in full details and in your own words. I reall...
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and s...
Q: What are interchromatin compartments ?
A: A cell is comprised of several components including nucleus, cell membrane, and cell cytoplasm. Ther...
Q: How did the work of each of the following scientists—Garrod, Beadle and Tatum, and Pauling— contribu...
A: Gene can be described as the unit of heredity that comprises the information related to the generati...
Q: F1
A: Phenotype-the ratio of offspring manifesting a particular trait. F1-the first flial generation seeds...
Q: A trihybrid individual with the genotype QqRrTt is testcrossed with a qqrrtt individual. The resulti...
A: A trihybrid cross is a cross between two individuals of the same species for the purpose of studying...
Q: Often reliquishing the young ones owing to food shortage is one of the common behaviour exhibited by...
A: Animal behaviour is the research of how animals navigate around in their surroundings, engage cooper...
Q: Topic: Isolation of Crude Ovalbumin from Egg White by Ammonium Sulfate Precipitation (Salting Out) ...
A: Egg white It refers to the clear liquid present inside the egg. It is formed from the layers of secr...
Q: 13) True or false: fragmentation spectra obtained from a mass spectrometer can help identify molecul...
A: Mass spectrometry is a technique for determining the mass-to-charge ratio (m/z) of one or more molec...
Q: Discuss the 4 lobes of the brain its function and relation to our behavior
A: Our brain is divided into 4 different areas that execute particular functions, these are known as lo...
Q: Give at least 1 sample each then illustrates them. Please see attached picture.
A: Personal Protective Equipments or (PPEs) are clothing and equipments that are designed to protect or...
Q: 6 Question 6 ECM lysosome flagellum microtubule centrosome rough ER smooth ER nucleolus nuclear pore...
A: A diagram of animal cell is given. Have to label various organelles and parts of animal cell.
Q: Describe alleles and why they occur on homologous chromosomesof sexual reproducers
A: The term "chromosome" is derived from the Greek word for "color (chroma) and body (soma)." Thread-li...
Q: There are two broad classes of transposons. Each class is characterized by its method of "jumping" (...
A:
If Marge’s father is a heterozygous tall Zork and her mother is a short Zork, what isMarge’s genotype?Complete the Punnett square to show the possible genotypes that would result to help you determine Marge’s genotype.What is Marge’s genotype?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A woman and a man have a red-green colorblind daughter. What can you say about the genotypes of the parents? Be specific and complete, using correct conventional notation.In this pedigree chart, what is the genotype of individual III-1? (It's circled in blue.)Assume that one of Merida's sons, who is heterozygous for orange hair color, married a girl that was also heterozygous. Create a Punnett square to show the possibilities that would result if they had children. a. List the possible genotypes and phenotypes for their children. b. What are the chances of a child with orange hair? c. What are the chantes of a child with yellow?
- Using the pedigree, assume that the disease is caused by an autosomal dominant allele, R. Give the genotype of the following individuals: (a) III-4 (the girl at lower right) (b) II-3 (the girl’s mother) (c) II-4 (the girl’s father)A typical pedigree for a family that carries neurofibromatosis is shown below. Note that carriers are not indicated with half-colored shapes in this chart. Use the letter "N" to indicate the dominant neurofibromatosis allele, and the letter "n" for the normal allele. Use the below pedigree chart and your knowledge on how to interpret a pedigree chart to answer questions # 7-9. 1 Nn nn nn 3 nn 7. Is individual #1 most likely homozygous dominant or heterozygous? Explain how you can tell. 8. What is the genotype of individual #2? Explain how you can tell. 9. What is the genotype of individual #3? Explain how you can tell. 2)Refer to the pedigree below for this question. Individuals who are shaded have a rare autosomal recessive disorder. Those who are not shaded have the dominant phenotype. Let "A' and a represent the dominant and recessive alleles, respectively. Fill in the probability functions below to indicate the genotype or probability function for the genotype af each individual. Give all probabilities as fractions that are simplified to the lowest value. Type your fractions in ## format without spaces. For example, one-half should be typed as 1/2. Place a zero in each space that does not have a number. Individual 3 is genotype 0 AA + 1 Aa + 0 aa Individual Il-4 is genotype 1/3 AA + 2/3 Aa + 0 aa Individual -1 is genotype AA + Aa + aa Individual Il-1 is genotype AA + Aa + aa Individual Il-7 is genotype AA + Aa + aa Individual I-1 is notype AA + aa Individual lII-5 is genotype AA + Aa + aa Individual IV-3 is genotype AA + Aa + aa For the next question, give the probability as a fraction that is…
- Shown above is a family pedigree tree in which family members afflictedwith the disease Haemophilia are shown with filled-in squares (male) or circles (females). A couple is trying to determine the likelihood of passingon the disease to their future children (represented by the ? symbolabove) because the hemophilia runs in the woman’s family. Turner syndrome is a disease in which an individual is bornwith only a single X chromosome. Suppose the woman in thecouple is a carrier for hemophilia and has a child with Turnersyndrome. Would this child have the disease?Two people are planning to have children together. Each person is heterozygous for the gene “G”. Using this letter, first list all the possible gametes that the two people can produce. Next, write all the possible genotypes and phenotypes for their offspring, using the correct genetic terminology (e.g., “genotype is homozygous dominant” “phenotype is dominant”). HINT: Use the gametes to construct a Punnett square and predict the possible offspring (you do not need to include the Punnett square in your answerTwo people are planning to have children together. Each person is heterozygous for the gene “A”. Using this letter, first list all the possible gametes that the two people can produce. Next, write all the possible genotypes and phenotypes for their offspring, using the correct genetic terminology (e.g., “genotype is homozygous dominant” “phenotype is dominant”). HINT: Use the gametes to construct a Punnett square and predict the possible offspring (you do not need to include the Punnett square in your answer).
- Frank and Susan both have freckles but they're firstborn son Lawrence does not demonstrate the characteristics. What are the most likely genotype of Frank Susan and Lawrence?If a man with dark skin whose genotype is AaBB reproduces with a woman who has light skin (aaBb), what are the possible skin colors that their children will have? Develop a Punnett square and list the possible genotypes & phenotypes. For your convenience, a table is presented below that shows several possible genotypes & phenotypes: Genotypes Phenotypes AABB Very dark skin AABb or AaBB Dark skin AaBb, AAbb, or aaBB Medium brown skin Aabb or aaBb Light skin aabb Very light skinRefer to the pedigree below for this question. Individuals who are shaded have a rare autosomal recessive disorder. Those who are not shaded have the dominant phenotype. Let "A' and "a" represent the dominant and recessive alleles, respectively. Fill in the probability functions below to indicate the genotype or probability function for the genotype of each individual. Give all probabilities as fractions that are simplified to the lowest value. Type your fractions in ## format without spaces. For example, one-half should be typed as 1/2. Place a zero in each space that does not have a number. Failure to follow these instructions will result in your answer being marked as incorrect. Note that two of the individuals have been completed for you as examples. Individual 1-3 is genotype O AA + 1 Aa +0 aa Individual II-4 is genotype 1/3 AA + 2/3 Aa + 0 aa Individual 1-6 is genotype AA + Aa + aa Individual II-1 is genotype Aa + AA + aa Individual II-5 is genotype AA + Aa + aa Individual II-7…