For a closed-circular DNA molecule of 6,825 base pairs in the fully relaxed form, the linking number (Lk) is: 65 6825 650 700

Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences: 5'CGGAC3'

A and B (adnine, cytosine, guanine, thymine) C and D (G1, G2, G3, G4)

Please explain why the order is 3–1-4-2 and not another way, thank you so much. Question is in the image.

1). What is the concentration of a solution of DNA with an OD260 of 0.3? ----I got 15 micrograms/mL  (50 x 0.3)  2). How many microliters of this solution of DNA would you need if you wanted 1.5 micrograms?

The figure shows that the average distance between base pairs measured parallel to the axis of a DNA molecule is 3.4 Å. The average molar mass of a pair of nucleotides is 650 g•mol-1. Estimate the length in cm of a DNA molecule of molar mass 5.1x109 g•mol-1. 4.0 cm Roughly how many base pairs are contained in this molecule? 4.0 7.1e6 X base pairs AT CG OH O-P=D0 G C TA Adenine Thymine OH CH2 N-H.......O CH3 H -N N..... G C H A Он C G G C TA AT OH CH2 Cytosine Guanine H. O.......H-N H H' H N…**H-N HLH O N-H..... H2C OH TA OH CH2 (b) The most common structure of DNA, which is a right-handed double helix. The two strands are held together by hydrogen bonds and other intermolecular forces. (a) Base-pair formation between adenine (A) and thymine (T) and between cytosine (C) and guanine (G).

Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG 3' Reverse primer 5'TTCTAAGAAACTGTTAAGG 3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC 3'Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG 3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG 3'Reverse primer 5'CGGACCTTCATTGGCAATTCGA 3'

For the following sequence please design an 18 base pair REVERSE primer.  ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG

In Figure 1-8b, can you tell if the number of hydrogenbonds between adenine and thymine is the same as thatbetween cytosine and guanine? Do you think that aDNA molecule with a high content of A + T would bemore stable than one with high content of G + C?

Although A-form, B-form, and Z-form DNA are all left-handed, they exhibit different physical properties due to their different numbers of bases per turn. True False