HDAC OFF Sin3a MeGe2 Coactivators MeG CREB1 Repressor model ON Transcriptional activator model Structural model Splicing Chromatin remodeling MeC ATBX Brabma ON YB-1 MeCP2 Loop and recruit model Active gene modulator model
Q: 67 RNA interference was first discovered in Drosophila melanogaster. Yes or no 68 Which of the…
A:
Q: promoters Insulators are particular that control access of enhancers to translation transcription…
A: Introduction Gene expression is the process through which information from a gene is used to create…
Q: Put the following steps in the correct orderedsequence.a. kinase cascadeb. activation of a…
A: Ras gene encodes many signal transducted molecules, and all these molecules are associated with the…
Q: transcriptional repressor leading to decreased gene expression. a. chromatin remodelling complex…
A: Transcriptional repressors are the molecules that block/inhibit gene expression. They directly act…
Q: Mutation in the operator that reduces the affinity of the operator for the repressor protein…
A: Lac operon is an inducible operon. When lactose is present in medium, then lac operon starts.
Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…
A: During mutation, there is a change in the overall sequence of the gene, which can result in a change…
Q: Below is a diagram oT a gene that is not normally alternatively spliced. All Tour exons (represented…
A: Any change in a single nucleotide of a gene is called a point mutation.
Q: Select the descriptions that are specific for a general transcription factor Select 2 correct…
A: Correct options are: Option A i.e. transcription factor can act to repress or activate a certain…
Q: Through alternative splicing, eukaryotes (a) reinforce gene inactivation (b) prevent transcription…
A: The transcriptional process of genes has some differences in prokaryotic cells and eukaryotic cells.…
Q: Identify three key ways that TrXG genes promote transcription
A: In the metazoans the TrXg genes help in the regulation of the developmental processes along with the…
Q: Binding of transcription activator protein O Gene is switched ON Gene is switched OFF Does NOT…
A: A transcriptional activator is a protein which is also called the transcription factor.
Q: Explain why the events shown in part (a) inhibittranscription.
A: According to the "central dogma, the genetic information transfer from “DNA to RNA” via…
Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…
A: A mutation is a change in the sequence of the DNA that may affect the codons of the DNA or mRNA.…
Q: What factors called mitogens stim-ulate cultured mammalian cells to proliferate by inducing…
A: Mitogens are biologically active polypeptides that induce cells to start division or increase the…
Q: Enhancers in eukaryotic genomes such as glucocorticoid response elements can upregulate multiple…
A: An Enhancer in Eukaryotic genomes is defined as the DNA sequence which promotes the transcription.…
Q: tatement about the HATS is FALSE? do not interact with non-pioneer regulatory transcription facto…
A: HATs : Histone acetyl transferases. These are the enzymes that acetylate conserved lysine residuals…
Q: stream of their coding sequence. The interaction of these enhancers with specific pression. Gene A…
A: Transcription elements Are defined as the type of proteins that have the ability to do modification…
Q: Indicate whether the protein binds directly or indirectly (assuming it does) to DNA and whether to…
A: Introduction :- DNA acts the genetic material of the cell because it have all the genetic…
Q: Define the following terms:a. Crabtree effectb. transcription factorc. response elementd. insuline.…
A: The Crabtree Effect occurs in metabolically adapted cell lines are grown in anaerobic conditions…
Q: Pre-initiation complex (PIC) is formed right before the initiation of genes, which of the following…
A: The preinitiation complex is a protein construct that forms in eukaryotic cells prior to…
Q: All may be RNA polymerase Il promoter constituents EXCEPT: (A a TATA box upstream the transcription…
A: * promoter is sequence of DNA where proteins binds initiate transcription of RNA from DNA downstream…
Q: Describe the 4 types of suppressor high copy suppression, bypass suppression, nonsense suppression,…
A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…
Q: of gene. 12. Steroid hormone receptor complex binds to the A. transcription start site B. promoter…
A: Steroid hormones are lipid-soluble molecules that can easily diffuse through the cell membrane to…
Q: Select the descriptions that are specific for a regulatory transcription factor (RTF) Select 4…
A: Genes are the fundamental unit of heredity. They store genetic information in the form of DNA, which…
Q: c) You use chromatin immunoprecipitation to measure the location and amount of transcription factors…
A: Transcription factors are protein molecules which bind to specific DNA sequences to regulate gene…
Q: Enhancers contain binding sites for transcription factors that regulate transcription. are…
A: Enhancers Enhancers are found in the upstream of DNA. They are short sequence about 50 to 1500 base…
Q: Examine Figure 17.7. What would be the effect on transcription if a mutation occurred in the gene…
A: The process of formation of mRNA from the template DNA is termed as transcription. Mutation hampers…
Q: Suppose MYC regulates gene X by recruiting DNA methyltransferases (DNMTS). Which of the following…
A: cis regulatory elements are regions of non coding DNA which regulate transcription of neighbouring…
Q: A researcher is trying to identify regulatory DNA sequences near a gene of interes- Several modified…
A: An enhancer is a a short region of DNA that when present either upstream or downstream of a gene can…
Q: The transcription of a gene called YFG (your favoritegene) is activated when three transcription…
A: An enhanceosome is a group of trans-acting factors that assemble at an enhancer region of a gene to…
Q: If a cell cannot make any Rb protein, how will this affect the function of E2F?
A: Mutation in the deoxyribonucleic acid (DNA) can cause cancer. Abnormal and unnecessary growth of…
Q: Splicing regulatory (SR) proteins bind at exon to recruit U1snRNP and U2 snRNP during RNA splicing.…
A: There are few important points about splicing apparatus are as follows: The central component of…
Q: Transcriptional enhancers are: O A operator sequences that repress transcription by blocking RNA…
A: Transcription is the mechanism by which an RNA duplicate of a gene arrangement is created. This…
Q: Repressors bind toa) Promoterb) Enhancerc) Operatord) Hormone response element
A: A repressor is a protein that can bind to DNA or RNA and inhibits gene expression. The DNA-binding…
Q: The chart below is a position specific scoring matrix (PSSM, a logarithmic transformed matrix) for a…
A: Hi, Thanks For Your Question. Q2. Answer : The Maximum Score That A Sequence Can Have With This…
Q: In eukaryotes, transcription factor activators bind to their enhancer elements and interact with RNA…
A: Transcription factors These factors are responsible for the process of transcription. These proteins…
Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…
A: Translation is the formation of protein from the mRNA in the cytoplasm.
Q: Wilms tumor 1, or nephroblastoma, is caused by mutations in the WT1 gene, which encodes a…
A: Molecular biology is an emerging field which focuses on the molecular basis of all biological…
Q: Choose all that apply regarding gene transcription in eukaryotes: Multiple transcription factors are…
A: Transcription in eukaryotes.
Q: . Dosage compensation is necessary because a. some regions of the genome contain more genes than…
A: Introduction : Heterochromatin is the darkly stained part of chromatin. The heterochromatin is…
Q: If a repressor prevents TFIID from binding to the TATA box, why does this inhibit transcription?
A: Genes are composed to make the control of gene expression simpler. The promoter region is promptly…
Q: A mutated form of gene x has been isolated (X1). Its transcript abundance displays constitutive…
A: A constitutive mutant a mutation in gene that increases the gene expression and gene product is…
Q: HOw does dimerization of transcriptional regulators Increase their specITICity for target DNA…
A: Transcription Factors -- Transcription factors are integrated multiple signal transduction pathways…
Q: The following diagram depicts the elements at the: Ac TTC g99 Eca cgcc tataan ATT BRE TATA box Inr…
A: The core promoters are contiguous DNA sequences sufficient to initiate the accurate initiation of…
Q: Operator | Choose Choose) A set of genes transcribed together under the regulatory control of a…
A: In the above question there are some operon and some parts of operon. Every parts has its different…
Q: 1. Directly to enhancer RNA polymerase II 2. Directly to promoter Indirect repressors 3. Indirectly…
A: The genome contain genes, which are the regions of DNA that gets transcribed to RNA. Only a small…
Q: Why do promoter mutations cluster at positions −10and −35 as shown in Figure 11-11? Which…
A: Introduction A promoter is a DNA region where RNA polymerase starts transcription of a gene.…
Q: DA Different response elements located upstream of the promoter of the prokaryotic and eukaryotic…
A: Response elements are the portion of the gene with a short sequence of DNA within the promoter or…
Explain this cycle.
Step by step
Solved in 5 steps
- You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 AGATACGCGATGATATTACTGCTA AAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАССССТАCGTGATAG 3' TТCGAGCTCTСGTCGTCGAGA ПААТАТСGGGATGCАСТАТ С 5' RNA promoter polymerase Practice Question 4 G) You also study the expression of different mutants for this gene. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? For mutant C answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any)…. What is an enhanceosome? Why could a mutation in anyone of the enhanceosome proteins severely reduce thetranscription rate?I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…
- Can I get help on drawing a mechanism for the paragraph below? p53 stabilization by IR The signal upstream of p53 stabilization and activation after IR exposure most likely originate from DNA DSBs. This is supported by the fact that the kinases implicated in the phosphorylation of p53 are also implicated in DSB repair. These include two kinases that belong to the PI-3 kinase family, DNA-PK and ATM (see above), and indirectly, the checkpoint kinase 2 (Chk2). Ser15 of p53 was identified as a substrate for DNA-PK in vitro (Lees-Miller et al., 1992). Since DNA-PK is required for DSB repair in mammalian cells after IR exposure and since this residue falls within the MDM2-binding domain of the protein, this was an attractive model of p53 stabilization after IR. However, several recent reports have shown that Ser15 of p53 is phosphorylated in cells deficient in DNA-PK and that p53 accumulation in these cells is capable of generating cell cycle arrest or apoptosis after IR (Abraham et al.,…You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAA! AAGCTCGAGAGCAGCAGCTСТАTGCGCTAСТАТААТGACСАТТАТАССССТАСGTGATAG 3' СTGGIAATATOGGGATGCACTАТС 5' RNA promoter polymerase Practice Question 4 F) You also study the expression of different mutants for this gene. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above). For mutant B answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter m in…Alternative splicing is a common mechanism for eukaryotes toexpand their repertoire of gene functions. At least one estimateindicates that approximately 50 percent of human genes usealternative splicing, and approximately 15 percent of diseasecausingmutations involve aberrant alternative splicing. Differenttissues show remarkably different frequencies of alternativesplicing, with the brain accounting for approximately 18 percentof such events. Why might some tissues engage in more alternative splicingthan others?
- You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 20 ORI 40 60 3' ТТCGAGCTCTCСТCGTCGAGATACGCGAT SCGATGATATTAC: ТАСTGGTAATАTоGGGATGCACTAТС AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCANTATAÇCCCTACGTGATAG ΤΑTC 5' promoter RNA polymerase Practice Question 4 B) What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3' ribosomeocument/d/1J-wo90GpYsd_jQSUBtDQHWisqGvSOteUQYoXaXazyS0/edit uction to cell.. R 1 Summary of Philo... E Petrona Andres Mig.. 2 Translations IXL: Par... IXL - Translations: g.. 1 IXL- meostasis Lab Exercise Tools Add-ons Help Last edit was 2 days ago text Calibri 12 BIU Conclusion: 1. List the changes you observed in the body color and perspiration level in response to? 2. Explain how the changes help the body adjust to maintain equilibrium (homeostasis)? 3. Speculate why a change in body temperature occurs? 4. Name which mechanisms your body uses to maintain a constant body temperature? 5. Explain why an increased breathing rate accompanies exercise? 6. Explain why an increased heart rate accompanies exercise? 7. Write a paragraph about the conclusions you can draw about your body's ability to maintain equilibrium (homeostasis). Be sure to include the answers to the questions above.Which of the following small GTP-binding proteins does NOT play a role in cell migration during chemotaxis? O Cap Z Rho Cdc42 O All of the listed GTPases play a role in cell migration O Rac ◆ Previous
- Create a metabolism cocept map using these terms RepressorInducer RiboswitchRepression InductionPositive regulationActivatorOperator Heat shocklac operontrp operon Catabolite RepressionHeat shocksigma-32 Negative regulationTwo-component regulationSensor Kinase Autoinducing Peptide (AIP)Response regulatorSigma factorsFeedback inhibitionProtein StabilityQuorum SensingRNA regulationAntisense RNAHomoserine Lactone (AHL)* Google Translate x + re.com/courses/49703/quizzes/244266/take/questions/5315835 Understanding BAC-23 better might be the difference in curing cancer and saving millions of lives! You must sequence its genome and find the genetic code that makes the cancer curing protein. After running several tests, you have found the correct gene segment to be: GGG UCG ACA CUC UUU. Remember that bacteria are weird and their genes are made from a single strand with ribose sugar backbones! 1. Give the correct DNA template for this bacterial gene segment (GGG UCG ACA CUC UUU). ***Please use the following format or it will be marked incorrect*** Example: ABC DEF GHI JKL MNO, all caps, organized in threes with a space in between. Please make my life easier 2. Using the genetic code provided (GGG UCG ACA CUC UUU), translate this gene segment. ***Please use the following format or it will be marked incorrect*** Example: ABC DEF GHI JKL MNO, all caps, organized in threes with a space in between. Please make…Which of the following would be used to describe a gene that is transcriptionally controlled by activator ahd/or repressor proteins? Constitutive Regulated Environmental-independent. Permanently repressed. Permanently enhanced. Moving to another question will save this response. 144 Hz ms CURVED Optix MAG271C CAMING Firameless Desgn Gomine Os0 APP msi High Rofresh Rate Fast Respense Time Curved Gaming