Q: Give typing answer with explanation and conclusion What class of biomolecule makes up the cell wall…
A: A rigid and protective layer which surrounds the plant cell is called cell wall. It plays a crucial…
Q: According to the FPH, the overall goals for Laura's program should be... To improve self-esteem,…
A: Based on the information provided, option 3 would be the most appropriate answer. The overall goals…
Q: If hypertrichosis was an incomplete autosomal dominant trait, rather than a complete dominant trait,…
A: An autosomal dominant trait is a pattern of inheritance where a single copy of a gene mutation on…
Q: For the species : limentis arthemis provide the following information: 1. Species name/common name…
A: A species is a fundamental classification category used to group individual organisms that share…
Q: Question 1. Describe an action potential in a muscle fiber in detail, know the changes in voltage…
A: An action potential is a brief electrical signal that travels along the membrane of a neuron or…
Q: Antibiotic sensitivity testing: The Kirby-Bauer. 1) What do the following terms mean? a. PPNG b.…
A: Antibiotic sensitivity testing is a laboratory technique used to determine the susceptibility of…
Q: A Punnett Square is a diagram used to predict possible combination of dominant and recessive genes…
A: There are different types of inheritance pattern. Mendel only approved complete dominance after that…
Q: Which of the following is an example of a post-translational modification? Select an answer and…
A: Post-translational modifications (PTMs) are chemical modifications that occur on a protein after it…
Q: Compare and contrast disease transmission, using examples, Contact, vehicle, and vector.
A: Disease transmission refers to the process by which infectious agents are spread from one individual…
Q: Produce a Punnett square to illustrate the dihybrid cross described below (NOTE: It is the same…
A: Let's assume P represent the dominant normal functional allele (i.e denotes the gene for able to…
Q: Organize the following steps in order of antibody production. A. CD40L-CD40 interaction turn on…
A: The process of antibody production begins with the activation of a CD4 T cell by a dendritic cell…
Q: 1.How is acid or alkaline detected in a culture medium as an end product? 1.The tests for the…
A: Biochemical tests are laboratory techniques used to identify and characterize different types of…
Q: You isolate bacteria from several different pools at the recreation center. Curious about which…
A: BLAST are the tools that are used to identify the differences and similarities between the protein…
Q: What is the enzyme used to create DNA complementary to mature mRNA? Group of answer choices ligase…
A: The complementary strand refers to the nucleic acid strand that is synthesized to match and pair…
Q: Which of the following is the best definition of generation time in a bacterium? the time it takes…
A: Bacterial growth refers to the increase in the number of bacterial cells in a population over time.…
Q: Label the figure to describe how DNA folds into a visible chromosome. Nucleosome Histones Centromere…
A: DNA (deoxyribonucleic acid) is the genetic material in most of the organisms. It is a double…
Q: PLEASE ANSWER THE QUESTION AND EXPLAIN SUCCINTLY IN 2 SENTENCES
A: The given question states some concerned data matching to be solved. The black balls refers to…
Q: Why do we think that the forest communities of eastern North America have changed dramatically over…
A: Ecological succession is the process by which an ecological community changes and develops over time…
Q: Oligosaccharides are usually attached to proteins on loops or turns that project from the protein…
A: The interaction between proteins and sugar molecules, known as oligosaccharides, plays a vital role…
Q: What new amino acids might be substituted for proline after treatment with 5-BUDR? (This mutagen…
A: Five Promo Russell is a mutagenic analogue of the mean that can incorporate into DNA during…
Q: Which figure (A, B, or C below) corresponds to each of the following, where curves repre…
A: There are environmental factors that affect the chance of survival of organisms. These are called…
Q: If the mean trait value in Generation 1 is 5, and the mean trait value of the individuals in…
A: The selection differential denoted by S is the difference in the mean value of the trait of the…
Q: The two primates shown below both exhibit large eye orbits. One is a tarsier, the other is an owl…
A: Evolution is the process of change in a species over time as a result of adaptations and mutations…
Q: Multiple steps in signaling pathways allow for signal amplification. Each step can be magnified (a)…
A: A signaling pathway is a series of chemical reactions and interactions that occur within a cell in…
Q: Please place the stages of a CRISPR-cas9 gene editing workflow in the correct order below. Note,…
A: CRISPR-Cas9 gene editing is a powerful molecular tool that allows scientists to selectively modify…
Q: Which type of primate is associated with these traits: grooming claw, dental comb, postorbital bar,…
A: What are primates ? Any mammal belonging to the group comprising lemurs, lorises, tarsiers, monkeys,…
Q: 1. Complete the following chart: CHEMOTHERAPEUTIC AGENT DISK CODE Streptomycin 10 Neomycin…
A: The disk zone inhibition test is the sensitivity test for various bacterial species against specific…
Q: describe the four distinguishing characteristics of chordata a d the structural, functional, and…
A: "Since you have posted more than one question at a time, we will provide the solution only to the…
Q: Measure the migration of each band in the marker lane from the well. Using a semi-log scale, plot…
A: Electrophoresis is defined as the migration of charged particles under the influence of an electric…
Q: Which is an example of secondary succession? Mark only one oval. A) Beach grasses colonize a newly…
A: Secondary succession is the process of ecological succession that occurs after a disturbance that…
Q: A 16 year old boy has been prescribed the cytotoxic medication fludarabine 10mg film coated tablets…
A: Fludarabine is a chemotherapy drug that is used to treat several types of cancer including leukemia,…
Q: Answer the questions below to help you write your case summary. 2. Use the scroll bar on the right…
A: Kidney failure is also known as renal failure which can be diagnosed through a combination of…
Q: The efffectiveness of the spread plate method in microbiology.
A: A common approach in microbiology for isolating and quantifying microorganisms from a mixed culture…
Q: what aspects of ernst haeckels book led to criticism by his peers
A: Ernst Haeckel was a well-known German biologist and philosopher who lived in the nineteenth century.…
Q: Why does inbreeding lead to an increase in recessive deleterious traits (for example inbreeding…
A: Breeding is the process of mating selected individuals of a particular species with desirable traits…
Q: What is one thing in our modern environment that we are better adapted to than in our…
A: In genetics fitness is a measure of a person's capacity for surviving and procreating in their…
Q: Let us assume that an insect population in its first year has 5 individuals, in its second year has…
A: The change in the number of individuals in a population over time is called population growth. This…
Q: WHICH OF THE FOLLOWING STATEMENTS IS CONSISTENT WITH THE RESULTS OF THE EXPERIMENT?…
A: Cancer cells have increased energetic requirements due to their rapid division compared to normal…
Q: Which of the following mechanisms does HIV use to evade detection by immune responses from T cells…
A: HIV stands for Human Immunodeficiency Virus. It is a retrovirus that infects human immune cells,…
Q: Which two organs of our body are most susceptible to drug toxicity and why?
A: Drug toxicity refers to the harmful effects of a drug or medication on an organism or its cells,…
Q: Choose the single most appropriate description of how most Next Generation sequencing methods work.…
A: Sequencing is the process of determining the order of nucleotides (adenine, guanine, cytosine and…
Q: D Question 5 The main goal of utilizing the RNA-seq technique is to generate a: genome annotation.…
A: RNA sequencing (RNA-seq) is a high-throughput technique that is used to analyze the transcriptome of…
Q: Can an organism that doesn't utilize citrate grow on the Citrate agar we use in class? O It depends.…
A: Microorganisms are the tiny organisms that cannot be seen as such through naked eyes but require…
Q: How is a B-blocker different than a diuretic? Mark all that are correct. A diuretic lowers mean…
A: Diuretics assist in flushing out excess water and salt from the human body. Most of these drugs…
Q: 1. A region of DNA in a particular cell synthesizes a segment of RNA that is 174 bases long and in…
A: The DNA is the genetic material in living organisms that is responsible for the production of RNA by…
Q: Based on the information from the following table and the provided phylogenetic tree, what kind of…
A: Classification means the arrangement of various species into a groups. In the world there are lots…
Q: Part C Using the table as a guide, research and evaluate two forms of renewable energy. Use reliable…
A: Those sources of energy which are not based on the burning of fossil fuels are called renewable…
Q: 9. There is a negative correlation between the sleep patterns of owls and humans: owls are more…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: Three corn seed traits are C for red, c for white; S for plump, s for shrunken; W for normal, w for…
A: To map the distances and order of the three loci (C, S, and W), we need to first calculate the…
Q: Transposon mutagenesis
A: Transposons: These are also known as jumping genes. These are the segments of DNA which can move or…
Nucleotides
It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).
Nucleic Acids
Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.
Can choose more then 1 option
Do not copy paste and provide answer in text format only please.
Thanks
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- Consider the positively charged amino acid lysine Lys2+ 21 COOH I H&N-C-H I pH 14 12 10 8 6 4 2 0 CH₂ I CH₂ I CH₂ I CH₂ T NH₂+ 0 Nelson p85 2.18 = 2.18 PK₁ Lys+ COO™ I H₂N-C-H H₂N-C-H ī I -----) 8.95 Lysº 8.95 pK₂ pka carboxyl = 2.19 pkaamino = 9.67 pka sidechain = 4.25 COO™ I CH₂ I CH₂ I CH₂ I CH₂ I NH₂¹ 1.0 2.0 Equivalents of OH added- COO™ I H₂N-C-H I 10.79 1 10.79 pk Isoelectric point Lys CH₂2 I CH₂ I CH₂ I CH₂ T NH₂ 3.0 +H3N NH3+ T CH₂ T CH₂ CH₂ CH₂ -COO™ H Lysine (Lys, K) Physiological pH = 7.4 < pl → Amino acid is positively charged at physiological pH 1. Consider glutamate in its fully protonated form (e.g. in a pH = 1 solution) 1) Draw all the forms of glutamate at various pH 2) Calculate the pl of this amino acid 3) Sketch a titration curve showing pH as a function of added [OH-] and locate the predominant forms of histidine in the curve STEPS: 1. Find the H atoms that can be removed on the molecule 2. Associated a pka value to each removable H. 3. Draw the Aa structure at:…why is CH3-CH-CH2-CH2-CH3 non imposable ? I OHWhich of the following is an anomer of B-D-gulopyranose? O O го ОН H ОН H ОН H H ОН CH₂OH -II- H H ОН ОН CH2OH H ОН ОН CH2OH О 0. H CH2OH то Н H H ОН H H - о H ОН ОН H ОН H ОН ОН H О ОН ОН H N
- Identify the type of bond between the water molecules indicated by arrow "A" Red Balls Oxygen Blue Balls Hydrogen ionic hydrogen covalentWhat is the sequence of the protein that would be translated from the following mRNA molecule? Use the single letter amino acid abbreviation for your answer. 5'- UGAUGUACCUCGCCUCUACGACGGAAUCCACA - 3'The alkaline hydrolysis of pAUGCAGC oligonucleotide produces: O A. Uridine 2'-monophosphate, uridine 3'-monophosphate, cytosine 2'-monophosphate O B. Adenosine 2'-monophosphate, adenosine 3'-monophosphate, adenosine 21,5'-bisphosphate OC. Guanosine 2'-monophosphate, guanosine 3'-monophosphate, cytosine 3'-monophosphate O D. Cytidine 3'-monophosphate, guanosine 2'-monophosphate, adenine 2'-monophosphate O E. Adenine 3,5'-bisphosphate, guanine 2,5'-bisphosphate, uridine 2'-monophosphate O F. Uridine 2'-monophosphate, uridine 3'-monophosphate, guanine 3'-monophosphate
- This is a portion of the periodic table of elements. What is the atomic mass of arsenic (As)? 3 Li 6.941 11 Na 22.99 19 K 39.10 18 26.98 39.95 74.92 33 4 Be 9.012 12 Mg 24.31 5 B 10.81 13 Al 26.98 6 C 12.01 14 Si 28.09 20 31 32 Ca Ga Ge 40.08 69.72 72.59 7 N 14.01 8 O 16.00 15 16 P S 30.97 32.07 9 F 19.00 17 Cl 35.45 33 34 35 As Se Br 74.92 78.96 79.90 10 Ne 20.18 18 Ar 39.95 36 Kr 83.60A nonapeptide was treated with dithiothreitol to reduce any disulfide bridges, then partially hydrolyzed, giving rise to the following fragments. What was the sequence of the original polypeptide? Phe-Gln-Asn Pro-Arg-Gly-NH2 Cys-Tyr-Phe Asn-Cys-Pro-Arg Tyr-Phe-Gln-Asn O Cys-Tyr-Phe-GIn-Asn-Cys-Pro-Arg-Gly-NH2 O H2N-Gly-Arg-Pro-Cys-Asn-Gln-Phe-Tyr-Cys O Gly-Arg-Pro-Cys-Tyr-Phe-Gln-Asn-Cys-NH2 Cys-Pro-Arg-Gly-NH2-Cys-Tyr-Phe-Gln-Asn O None of these are correct.The anomer of a-D-glucopyranose is CH:OH он ÓH CH2OH он он он он CH,OH он он он он CH,OH он OH он ÓH ÇH;OH он он он он
- First letter U C A UUU UU JUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG ] Phenylalanine UCU (Phe) UCC UCA UCG Leucine (Leu) Leucine (Leu) Isoleucine (Ile) Methionine (Met) Valine (Val) CCU CCC CCA CCG b) lysine c) methionine d) tryptophan ACU ACC ACA ACG GCU GCC GCA GCG C Second letter Serine (Ser) Proline (Pro) Threonine (Thr) Alanine (Ala) UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG ] Tyrosine (Tyr) Stop Stop Histidine (His) Glutamine (Gln) Asparagine (Asn) Lysine (Lys) Aspartic acid (Asp) Glutamic acid (Glu) UGU UGC UGA Stop UGG Tryptophan (Trp) CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG ] 1. List the mRNA base codons for the amino acids listed below. 2. a) aspartate: Cysteine (Cys) Serine (Ser) U C Arginine (Arg) A G Arginine (Arg) U C Glycine (Gly) A G U C A G U MCAG Аadenine molecule ii. NH2 N- НО-Р—О—Р—О—Р—О. ОН ОН ОН i. Phosphate chain ОН ОН iii ribose sugarWhat is the DNA sequence for the molecule shown here? НаС, OH 0- NH, EN -0-P-o NH2 -0-P- NH2 -0-P- OH