Give typing answer with explanation and conclusion to all parts The pairing of the U1 snurp and the donor site signals what particular event? A. Identify the donor splice site. B. Identify/recognize intron. C. Keep the U6 RNA free from binding to the U1 RNA. D. Base pair with the nucleotides in the Branch site. E. De-branch the lariat and release the intron.

Give typing answer with explanation and conclusion to all parts The pairing of the U1 snurp and the donor site signals what particular event? A. Identify the donor splice site. B. Identify/recognize intron. C. Keep the U6 RNA free from binding to the U1 RNA. D. Base pair with the nucleotides in the Branch site. E. De-branch the lariat and release the intron.

Name: Give typing answer with explanation and conclusion to all parts The pa
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Give typing answer with explanation and conclusion to all parts The pairing of the U1 snurp and the donor site signals what particular event? A. Identify the donor splice site. B. Identify/recognize intron. C. Keep the U6 RNA free from binding to the

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Procedure This activity will use the Human β-hemoglobin gene, which is mutated in sickle cell anemia, with the following sequences of the first thirty (30) nucleotides: TAC CAC GTG GAC TGA GGA CAC CTC TTC AGA... 1. First transcribe the DNA sequence into the mRNA sequence. 2. Refer to the genetic code to write down the amino acid sequence that these 30 nucleotides encode beginning with the first nucleotide. 3. Generate a random number (1-30) by drawing lots in a bowl. Then locate the DNA nucleotide to "mutate" using the number drawn as the position along the gene. 4. "Roll" the tetrahedron "mutator" dice (see direction below for making the tetrahedron "mutator" dice). Note the letter on the side that is flat on the table. That is the nucleotide that will replace the nucleotide in the DNA at the position decided in the previous step. 5. Write the mutant nucleotide sequence in the row for Mutation 1, then analyze mutation. a. If it is the same nucleotide, write same nucleotide…
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
Why might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic mRNA? a. If the mutation occurs in the 5' end of the start site, it will not affect the gene product. b. If the mutation occurs in the exon, it will not affect the gene product. c. If the mutation occurs in the splice site of a transcript with alternative splicing, only one gene product may affected. O d. If the mutation occurs in the intron or not in the splice site of a transcript with alternative splicing, it will nc affect the gene product. O e. If the mutation occurs in the 3' end of the start site, it will not affect the gene product. OLIE STIC N 1A
Use the pre-mRNA sequence shown below to answer the following questions. MRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3' a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided. b. Predict what would happen if the G in the 5' splice site were mutated to a C. c. We learned in this topic that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation ? How can you experimentally demonstrate that a 5' cap is important for this process ?
Give typing answer with explanation and conclusion Which description applies to alternative mRNA splicing? 1. heritable changes in gene expression that occur without altering the DNA sequence 2. processing of exons in mRNA that results in a single gene coding for multiple proteins 3. mRNA modifications such as additions of a 5′‑cap and 3′ poly‑A tail and removal of introns 4. a gene cluster controlled by a single promoter that transcribes to a single mRNA strand 5. protein modifications such as addition of a functional group or structural changes such as folding Answer 2 is correct.
Which translation factor mediates the aminoacyl-tRNA entry into the A site of the ribosome? A. EF-Tu B. EF-Ts C. EF-G D. IF1
a. Mycobacteriophage genes occasionally begin with GUG or, even more rarely , UUG (rather than AUG ). Which amino acids corre spond to these codons ? b. Yeast genes occasionally begin with CUG, ACG , or AUC . Which amino acids correspond to these codons ?
Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…
Match Column A with Column B. transports amino acids to the site of protein synthesis has anticodon loop directs amino acid sequence of proteins contains the Shine-Delgarno sequence synthesized in the eukaryote nucleus found inside the ribosome region where the RNA binds to the DNA template…
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA: