Give typing answer with explanation and conclusion 8. Considering the principle of the Neutral Red bioassay, describe, in details, the expected appearance of the cheek/buccal cells if exposed to a toxic substance such as cigarette ash or possibly any other type of toxic substance.
Q: Explain the activities associated with the isolation of Bacillus megaterium organsim from mixed…
A: Bacteria are single-celled microorganisms that are prokaryotic in nature, meaning they lack a…
Q: Give an example of an early experiment in signal transduction and the photoreceptor that is…
A: Photoreceptors are specialized cells or proteins that sense light. Signal transduction is the method…
Q: You discover a new microorganism which you initially assume is a Bacterium, however after observing…
A: Archaea are a group of the micro-organisms that are similar to bacteria but evolutionarily it is…
Q: Which of the following is a necessary condition for natural selection to occur? The…
A: Natural selection It is defined as a mechanism of evolution in which organisms that are more adapted…
Q: Commensalism is a relationship between two species in which ____________________ Question 8…
A: Ecological relationship refers to the interactions and connections that exist between living…
Q: List 3 different ways in which food processors avoid problems from microorganisms (how do they…
A: Given below are the different steps taken by food processors to avoid microorganisms in food.
Q: Which types of mutations, among those you created in this activity, are more likely to cause the…
A: A mutation is a change that occurs in an organism's DNA sequence. Errors in DNA replication,…
Q: Compared to healthy individuals, the lungs' residual volumes of patients with emphysema is…
A: Lung care is vital for maintaining general health and avoiding respiratory illnesses such as…
Q: Describe a drug therapy that has been used for patients infected with SARS COV2. What does it…
A: Immunity can be defined as the ability of an organism to resist pathogenic organisms that can cause…
Q: In the morning, urine tends to be concentrated because _______ secretion of ADH _______. Group of…
A: ADH stands for Antidiuretic Hormone, which is also known as Vasopressin. It is a hormone produced by…
Q: Translate the following mRNA transcript 5’CGCCGAUGCGCGAUAUGUGGUAA’3 A. RRCAICG B. ADARYVV C.…
A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…
Q: Which of the following statements is false? Larval Elopomorphs disperse via ocean currents Several…
A: Lepisosteiformes is an order of ray-finned fish commonly known as gars. Gars are freshwater fish…
Q: 1. Order in which meats, proteins, fats, vitamins, minerals, additives should be ordered on a…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: Mutations cause variations among individuals. If these variations provide an advantage to…
A: The term "mutation" describes a shift or alteration in an organism's genetic code (DNA). Variables…
Q: order the stages of cell cycle from shortest (1) to longest (4). After the longest and shortest…
A: The process by which a cell replicates its genetic material and divides into two daughter cells is…
Q: A marine shark is best described as... A. A hypo-ionic, hypo-osmotic ammonotele B. A hypo-ionic,…
A: Marine sharks are ectothermic (cold-blooded) cartilaginous fishes that are adapted to life in…
Q: Tiktaalik is an extremely important Water to Land Transition animal because it is the exact…
A: Water to land transition animals, also known as tetrapodomorphs, are a group of organisms that…
Q: Explain mode of transmission for Guinea Worm Disease (Dracunculus medinensis). Go into some detail…
A: This is a question related to parasitology and public health. It involves understanding the mode of…
Q: After comparing the whole genome sequencing results from a candidate that you suspect has a mutation…
A: A missense mutation is a type of genetic mutation that results in the substitution of one nucleotide…
Q: Design a crispr crRNA portion of the gRNA for targeting myostatin gene in mo or tracerRNA which…
A: designing an effective gRNA for CRISPR-Cas9 gene editing requires careful consideration of various…
Q: Calculate the age of the Shroud of Turin given that the amount of ¹4C found in it is 92 percent of…
A: Radiocarbon dating is a technique that uses the decay of the radioactive isotope carbon-14 to…
Q: What type of signal sequence(s) would be used to create the ACE2 (type 1) integral membrane protein?
A: This question focuses on the type of signal sequences required to create a specific integral…
Q: Using what you know about osmosis, explain how drinking too much water can lead to the deadly…
A: Osmosis is a phenomena in which solvent molecules moves from its high concentration towards its low…
Q: Question 4. You have identified a mouse that develops a leaky gut with leakage of conents of the…
A: Connective tissue ,is a type of biological tissue that provides support, structure and connection…
Q: 10. Is the egg cell produced by meiosis or mitosis within an archegonium? Explain Obtain a prepared…
A: A life cycle refers to the sequence of developmental stages an organism goes through during its…
Q: the answer I was told was that the gap would remain in newly sythesized dna from lagging strand. How…
A: The main function of DNA ligase is to seal the gap that occurs in the lagging stand formation.…
Q: You said that "Exposure to an extremely salty environment, on the other hand, could potentially harm…
A: Sharks are hyperosmotic regulators, which means they maintain a higher concentration of solutes…
Q: A genotype is denoted by the alleles R and r. Will selection against the rr genotype ever lead to…
A: A genotype refers to the genetic makeup of an individual organism specifically the set of genes that…
Q: Which of the following does not represent an important component of a hydrostatic skeleto A.…
A: The hydrostatic skeleton is a type of skeletal system found in many invertebrates that controls…
Q: Exercise II Bryophyta: The Mosses Examine with the dissecting microscope the mosses that are…
A: Bryophyta belongs to the group of non-vascular plants commonly known as mosses. They are small,…
Q: Can you do the same for the Bacillus genus?
A: Bacillus genus is a Gram positive and can be obligate aerobic or facultative anaerobic motile…
Q: 2. What does NOT happen to the hybrid zone when gene flow is established? O Hybrids cease to form. O…
A: A hybrid zone is a geographic region where two populations of closely related species or subspecies…
Q: Give an brief explanation: Case study: A 69-year-old male is preparing to undergo a lung transplant.…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: List the benefits of increasing your healthy fats and the health issues that can arise from eating…
A: Fats, also known as lipids, are a type of nutrient that are essential to the human diet. They are…
Q: Most amino acids are taken up by cells for protein synthesis. Some get broken down to ______ and…
A: Proteins are very large molecules composed of basic units called amino acids. Proteins are extremely…
Q: Why wouldn't the Human ears, human heart, and valtar adrenals phenotype be 0% if that mix is lethal…
A: Lethal embryonic mix refers to a combination of genetic material that, when present in an embryo,…
Q: Now examine the demonstration slide of a c.s. of an immature lily anther and identify the four…
A: A cross-section of an immature lily anther was examined to identify the microsporangia, also known…
Q: BRET is a way to study protein-protein interactions. Describe BRET, and come up with one additional…
A: Protein-protein interaction (PPI) is the term used to describe the actual joining of two or more…
Q: what is active ingredient, mode of action and level of activity in Bleach
A: Bleach It refers to a strong and effective disinfectant that can be used to kill bacteria, fungi,…
Q: Name a bacterium for each category and describe where each comes from, and what symptoms they cause…
A: There are different types of bacteria are present in the body. They multiply rapidly and they crowd…
Q: M. hdusia (singular: indusium) (See text Figure 17-32, page 420). by specialized outgrowths of the…
A: Ferns are non flowering seedless vascular plants that reproduce through spores. They belong to the…
Q: How does pinching back a plant, such as Chrysanthemum, cause it to become more bushy
A: Pinching back a plant refers to the act of removing the tip of a plant's stem or a portion of its…
Q: draw the results of a flow cytometry experiment in which one set of cells is treated with vehicle…
A: Taxol is a microtubule-stabilizing drug commonly utilized to treat cancer and can actuate cell cycle…
Q: MATCH THE FF. WITH THE CHOICES BELOW TATA sequence CAAT nucleotide within core promoter 3…
A: Gene expression is a complicated process involving the interaction of different DNA elements with…
Q: What is Janka rating and semi-consistent density?
A: The Janka rating is a measure of the hardness of wood, which is determined by measuring the force…
Q: summarise the effects of cortisol and the tissues it acts upon.
A: Cortisol It is defined as a steroid hormone that is produced by our adrenal glands which are…
Q: Develop your diagnostic key. as with any road map, there is more than one way to get to any…
A: The given question requires in-depth data diagnosis and interpretation for each specific species of…
Q: Pre-lab questions (due at the start of the lab period on a separate sheet of paper) 1. Name the five…
A: As per Bartleby guidelines only one question could be answered if rest of the questions are not…
Q: it have gaps that would remain in newly synthesized DNA from lagging strand
A: DNA ligase enzyme helps in phosphodiester bond formation between the 3'-OH group at the end of one…
Q: Which of the following statements is true of the chameleon tongue but not of the human tongue? A. It…
A: A tongue is a muscular organ found in the mouth of most vertebrates including humans. It plays a…
Give typing answer with explanation and conclusion
8. Considering the principle of the Neutral Red bioassay, describe, in details, the expected appearance of the cheek/buccal cells if exposed to a toxic substance such as cigarette ash or possibly any other type of toxic substance.
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- INTERPRETATION OF RESULIS NEGATIVE: Two lines appear. One colored line should be in the control region (C), and another apparent colored or faded color line adjacent should be in the test region (T). This negative result indicates that the drug concentration is below the detectable level. POSITIVE: One colored line appears in the control region (C). No line appears in the test region (T). This positive result indicates that the drug concentration is above the detectable level. INVALID: Control line fails to appear. Insufficient specimen volume or incorrect procedural techniques are the most likely reasons for control line failure. Review the procedure and repeat the test using a new test panel. If the problem persists, discontinue using the lot immediately and contact your local distrībutor. READING OF RESULTS INTERPRETATION SONTROL TEST SAMPLE1. What is Du? ANSWERS TO QUESTIONS ON LABORATORY ASSAY NO.7 2. Why do we need test for Du when weak or no reaction is obtained in Rh typing? 3. What is required to demonstrate the presence of cells carrying a weak D antigen? 4. Explain the mechanism behind the existence of Dº. 5. Cite possible situations in which an attending physician would request for an emergency screening for the presence of "D" antigen.1. What is Du? ANSWERS TO QUESTIONS ON LABORATORY ASSAY NO.7 2. Why do we need test for Du when weak or no reaction is obtained in Rh typing? 3. What is required to demonstrate the presence of cells carrying a weak D antigen? 4. Explain the mechanism behind the existence of Du. 5. Cite possible situations in which an attending physician would request for an emergency screening for the presence of "D" antigen.
- State the principle of the antiglobulin test. Differentiate monoclonal from polyclonal and monospecific from polyspecific antihuman globulin (AHG) reagents.Answer the questions briefly and concisely. Describe the limitations of FANA Describe the other Assays for ANA testing What are the advantages of FANA over the other assays? Describe the limitations of the RF Agglutination test What are the sources of errors in RF agglutination?A. Prepare a diagram with labels showing the similarities and differences among the four major types of ELISA based on their capture and detection systems. A1. Give at least one clinical application for each type of ELISA. B. What is the purpose of adding horseradish peroxidase, alkaline phosphatase, and their respective substrates?
- C. Answer the following questions: 8. Why does the methylene blue dye stain the nuclei in onion cells? 9. What is the cause of the variation in color intensity in a biochemical test? 10. You have negative results on both the Benedict and Biuret tests but both look blue. Why?PLEASE ANSWER BRIEFLY. Thank you. 5. In hairy cell leukemias (HCL), tartrate resistant acid phosphatase is demonstrated. In your opinion, is this the most reliable test to diagnose HCL at present. Explain in not more than 3 sentences. 6. The use of monoclonal antibodies to detect cluster of differentiation (CD) in leukemic cells, mostly immature cells is common in the laboratory. Why do you think this is more valuable than morphological examination of cells in the blood/bone marrow cells.1. What is an antiserum? 2. What are the potency requirements in an antiserum? ANSWERS TO QUESTIONS ON LABORATORY ASSAY NO.4 3. What kind of antigen will anti-A detect? Anti-B? 4. Enumerate the common causes of false positive and false negative result in ABO forward grouping? 5. Give the purpose of Blood typing. 6. Cite the biochemical components of the ABO blood group accordingly. 7. Complete the table below Blood type A B 0 AB (positive/pos) for agglutination (negative/neg) for no agglutination Anti-A Anti-B
- Implementation Different stages of Crohn's disease require different treatment. Review the table and determine if the treatment is recommended for those patients in all stages, those with mild Crohn's disease, those with moderate Crohn's disease, or those with severe Crohn's disease. Check the appropriate boxes below. Low residue diet Surgery Corticosteroids Antibiotics Biologics Immunomodulators Aminosalicylates All Stages Mild Moderate Severe ☐ ☐ ☐ ☐ ☐ ☐ ☐22:23 1O 000 · 11:24 A9 OB1 r ll l 52% . +964 782 734 3923 2m541139927815107... Patient Encounter Part 3 The pretreatment workup is summarized below. Pathology: 47-year-old female with new diagnosis of infiltrating intraductal adenocarcinoma involving the left breast and regional node. Further tests on tumor samples indicated ER (8%), PR (negative), HER2 (negative), Ki-67 (72%), and grade (poorly differentiated). Intrinsic subtype (luminal B, HER2-negative). Radiology: FDG-PET/CT indicated a 5.3 x 2.5 cm mass in the left breast which appeared to extend to the epidermis of the skin; one node in the left axilla was also involved with tumor. No other evidence of distant disease was visualized. Laboratory: CBC, liver, and kidney function tests WNL, alkaline phosphatase and calcium are normal also. Stage: IB (T, N, M,) List the most important prognostic factors in this patient with newly diagnosed breast cancer. Assess the patient's level of risk for relapse. 50 SECTION 16 | ONCOLOGIC…When is Direct Coombs test done? Autoimmune haemolytic anaemia Drug induced red cells sensitization To detect anti-D All of the above Explanation: 2. What is the possible conclusion for a positive control with observed agglutination in Anti-human globulin testing? Repeat the test Correctly performed the test When the patient does have the disease and the result is not within the reference range All of the above Explanation: 3. Which of the following is an accurate course of action for an Indirect Antiglobulin test? Incubate all the three tubes for one hour at 37°C In the tube labelled as ‘T’, add two drops of Anti-A serum Add one drop of 5 % isotonic saline suspension of the pooled ‘O’ Rho (D) positive cells in each All of the above Explanation: 4. Which of the following scenario resulted in a false positive outcome? 5 % suspension in isotonic saline Transfusion of Rh-positive blood Drug induced red cells sensitization Over centrifugation Explanation: Explanation:…